\
| Variant ID: vg0500821426 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 821426 |
| Reference Allele: C | Alternative Allele: T,CTTAAAAGT |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 218. )
CCGAAGGGGGGTTCCCAACCGGCACCGTTTAGAGATTCTGTAGTAGTGAGTCTACGCTTAATATTTATAATTAGTGTCCAAACATCTGATGTGATAGGGA[C/T,CTTAAAAGT]
TTAAAAGTTTTAGTCCCGTCTAAACAGTGACAAAGGATCTTGAAAAGTTCAAATCTAGCTTATCACATTACATAACGCCTTCTCTAAACGGTTACAATTC
GAATTGTAACCGTTTAGAGAAGGCGTTATGTAATGTGATAAGCTAGATTTGAACTTTTCAAGATCCTTTGTCACTGTTTAGACGGGACTAAAACTTTTAA[G/A,ACTTTTAAG]
TCCCTATCACATCAGATGTTTGGACACTAATTATAAATATTAAGCGTAGACTCACTACTACAGAATCTCTAAACGGTGCCGGTTGGGAACCCCCCTTCGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.70% | 36.70% | 0.19% | 0.00% | CTTAAAAGT: 0.36% |
| All Indica | 2759 | 45.40% | 54.30% | 0.29% | 0.00% | CTTAAAAGT: 0.04% |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 28.30% | 71.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 31.40% | 68.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 34.60% | 65.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 66.20% | 33.60% | 0.11% | 0.00% | CTTAAAAGT: 0.11% |
| Indica Intermediate | 786 | 38.20% | 61.20% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 71.90% | 12.50% | 0.00% | 0.00% | CTTAAAAGT: 15.62% |
| Intermediate | 90 | 73.30% | 24.40% | 1.11% | 0.00% | CTTAAAAGT: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0500821426 | C -> T | LOC_Os05g02435.1 | upstream_gene_variant ; 119.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500821426 | C -> T | LOC_Os05g02430-LOC_Os05g02435 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500821426 | C -> CTTAAAAGT | LOC_Os05g02435.1 | upstream_gene_variant ; 118.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500821426 | C -> CTTAAAAGT | LOC_Os05g02430-LOC_Os05g02435 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0500821426 | NA | 2.69E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500821426 | NA | 7.04E-07 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500821426 | NA | 2.73E-08 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500821426 | NA | 7.07E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500821426 | NA | 8.49E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500821426 | NA | 3.74E-07 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500821426 | NA | 3.88E-06 | mr1812 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500821426 | 1.10E-06 | 1.10E-06 | mr1954 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500821426 | NA | 7.32E-14 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |