Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0500689055:

Variant ID: vg0500689055 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 689055
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGCTAGAAGGGATAAATGTCACCATGTCAGCATGTTCCACATTCACATTTTATTTCTCCTCATGAGCTTCTCGCCTTGTAAAACACCTCACAATGATT[C/G]
AACACAGAAAAACTCAAGAGTCACAATGATGTCAGAGAAAACTACACATAGTGATCAGTGGAACACCTGATGAAAAGAATTGAACACAAGGAGAGTTTTT

Reverse complement sequence

AAAAACTCTCCTTGTGTTCAATTCTTTTCATCAGGTGTTCCACTGATCACTATGTGTAGTTTTCTCTGACATCATTGTGACTCTTGAGTTTTTCTGTGTT[G/C]
AATCATTGTGAGGTGTTTTACAAGGCGAGAAGCTCATGAGGAGAAATAAAATGTGAATGTGGAACATGCTGACATGGTGACATTTATCCCTTCTAGCTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.50%	5.10%	0.42%	0.00%	NA
All Indica	2759	99.70%	0.20%	0.04%	0.00%	NA
All Japonica	1512	83.70%	15.10%	1.12%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.40%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	95.70%	3.70%	0.65%	0.00%	NA
Tropical Japonica	504	65.30%	32.90%	1.79%	0.00%	NA
Japonica Intermediate	241	84.20%	14.50%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	2.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500689055	C -> G	LOC_Os05g02180.1	downstream_gene_variant ; 2384.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500689055	C -> G	LOC_Os05g02200.1	downstream_gene_variant ; 1701.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500689055	C -> G	LOC_Os05g02190.1	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500689055	NA	1.53E-08	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500689055	NA	7.97E-07	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500689055	NA	1.55E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500689055	NA	1.07E-12	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500689055	NA	3.11E-08	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500689055	NA	6.40E-06	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500689055	NA	1.65E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500689055	NA	8.16E-11	mr1632_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500689055	NA	2.61E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500689055	NA	2.43E-10	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251