\
| Variant ID: vg0500670256 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 670256 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, G: 0.04, others allele: 0.00, population size: 116. )
TTATACCCCACAGAAACTATTTAATTATTAGACTTGGGAGCAAGTGTTTTACAAAAGCCTCACATACTTTCAAATATTTAAGAAAGGACAGGGCTGGAAG[C/G]
TCTCTAGTCCACATCGATCATATGGCACATTCCTAGAATTGCTTAACTTTTTTTTTTAGAAACTTGTGAAGTTGTGATTCAGTATTTAGGACATGTTTAA
TTAAACATGTCCTAAATACTGAATCACAACTTCACAAGTTTCTAAAAAAAAAAGTTAAGCAATTCTAGGAATGTGCCATATGATCGATGTGGACTAGAGA[G/C]
CTTCCAGCCCTGTCCTTTCTTAAATATTTGAAAGTATGTGAGGCTTTTGTAAAACACTTGCTCCCAAGTCTAATAATTAAATAGTTTCTGTGGGGTATAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 33.40% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 46.90% | 53.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 96.00% | 3.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 20.80% | 79.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 30.80% | 69.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 77.50% | 22.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 40.60% | 59.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 92.80% | 6.90% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0500670256 | C -> G | LOC_Os05g02160.1 | downstream_gene_variant ; 1993.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500670256 | C -> G | LOC_Os05g02150-LOC_Os05g02160 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0500670256 | NA | 7.06E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500670256 | NA | 3.51E-07 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500670256 | NA | 8.80E-06 | mr1306 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500670256 | NA | 3.39E-14 | mr1352 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500670256 | NA | 4.45E-08 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500670256 | NA | 7.71E-12 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500670256 | NA | 5.79E-06 | mr1751 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |