Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0500436518:

Variant ID: vg0500436518 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 436518
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

CCAACCTTGTTTGTTGCATTTTTTTTCTCTGAGTACTATCAATATATTTGTCCATCAATAATCATAAAGAAATAGCTAGTTTTAAAGTAGTAAAAAAATT[G/A]
AGATAAAGGTGGAGTACTCGAGTAGGGATGAAAACGCTTTGGAAAAAGACGAAAAACTCTTTTATCGTTTCCATTTCCATATTTTGTTCGAAATCGAAAA

Reverse complement sequence

TTTTCGATTTCGAACAAAATATGGAAATGGAAACGATAAAAGAGTTTTTCGTCTTTTTCCAAAGCGTTTTCATCCCTACTCGAGTACTCCACCTTTATCT[C/T]
AATTTTTTTACTACTTTAAAACTAGCTATTTCTTTATGATTATTGATGGACAAATATATTGATAGTACTCAGAGAAAAAAAATGCAACAAACAAGGTTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.20%	8.80%	0.02%	0.00%	NA
All Indica	2759	92.50%	7.50%	0.04%	0.00%	NA
All Japonica	1512	96.90%	3.10%	0.00%	0.00%	NA
Aus	269	42.40%	57.60%	0.00%	0.00%	NA
Indica I	595	86.20%	13.80%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.00%	2.00%	0.00%	0.00%	NA
Indica Intermediate	786	87.90%	12.00%	0.13%	0.00%	NA
Temperate Japonica	767	94.00%	6.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500436518	G -> A	LOC_Os05g01700.1	upstream_gene_variant ; 4782.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500436518	G -> A	LOC_Os05g01710.1	upstream_gene_variant ; 495.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500436518	G -> A	LOC_Os05g01710.3	upstream_gene_variant ; 492.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500436518	G -> A	LOC_Os05g01710.2	upstream_gene_variant ; 495.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500436518	G -> A	LOC_Os05g01700-LOC_Os05g01710	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500436518	NA	6.95E-06	mr1054	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	NA	2.23E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	NA	2.59E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	NA	1.67E-06	mr1171	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	NA	6.84E-06	mr1287	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	NA	8.91E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	NA	1.22E-06	mr1351	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	NA	1.89E-06	mr1372	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	NA	5.80E-07	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	NA	8.54E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	NA	4.93E-06	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	NA	4.58E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	NA	8.94E-08	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	5.59E-07	5.60E-07	mr1673	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	NA	6.38E-06	mr1724	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	NA	8.61E-07	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436518	NA	7.56E-07	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251