Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0435311304:

Variant ID: vg0435311304 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 35311304
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.08, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

CTCTGCACCCGGCCCGGTATCCAACAAACCTTCTTGCAGTGCGAGCACTTCAACTATCCAAGAAGACCTGACTAAATGTACAACATCAAATGTATGGTCT[T/C]
CTCTCTCTCTCTCTCTCTCTTTCAATCACCACACACACACATTGTCACACGCTTAATCACCGCCATCCGTCTTATTCCATGCCATTTATATATATATATA

Reverse complement sequence

TATATATATATATAAATGGCATGGAATAAGACGGATGGCGGTGATTAAGCGTGTGACAATGTGTGTGTGTGGTGATTGAAAGAGAGAGAGAGAGAGAGAG[A/G]
AGACCATACATTTGATGTTGTACATTTAGTCAGGTCTTCTTGGATAGTTGAAGTGCTCGCACTGCAAGAAGGTTTGTTGGATACCGGGCCGGGTGCAGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.10%	43.20%	3.72%	0.00%	NA
All Indica	2759	87.70%	6.10%	6.13%	0.00%	NA
All Japonica	1512	2.10%	97.80%	0.07%	0.00%	NA
Aus	269	8.90%	91.10%	0.00%	0.00%	NA
Indica I	595	92.60%	3.90%	3.53%	0.00%	NA
Indica II	465	94.20%	2.20%	3.66%	0.00%	NA
Indica III	913	84.70%	5.50%	9.86%	0.00%	NA
Indica Intermediate	786	83.80%	10.90%	5.22%	0.00%	NA
Temperate Japonica	767	0.40%	99.50%	0.13%	0.00%	NA
Tropical Japonica	504	3.40%	96.60%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	95.00%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	89.60%	1.04%	0.00%	NA
Intermediate	90	25.60%	68.90%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0435311304	T -> C	LOC_Os04g59390.1	upstream_gene_variant ; 2223.0bp to feature; MODIFIER	silent_mutation	Average:53.736; most accessible tissue: Callus, score: 88.996	N	N	N	N
vg0435311304	T -> C	LOC_Os04g59394.1	intron_variant ; MODIFIER	silent_mutation	Average:53.736; most accessible tissue: Callus, score: 88.996	N	N	N	N
vg0435311304	T -> C	LOC_Os04g59394.2	intron_variant ; MODIFIER	silent_mutation	Average:53.736; most accessible tissue: Callus, score: 88.996	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0435311304	NA	1.84E-26	mr1037	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	4.41E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	1.22E-57	mr1088	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	1.16E-50	mr1125	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	2.51E-16	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	3.83E-12	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	1.64E-31	mr1208	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	1.09E-11	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	9.10E-15	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	2.18E-10	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	3.70E-11	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	1.18E-06	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	1.00E-33	mr1404	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	6.75E-25	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	6.92E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	2.25E-24	mr1551	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	1.73E-16	mr1655	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	1.77E-58	mr1671	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	2.52E-17	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	1.13E-07	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	4.19E-42	mr1721	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	5.08E-32	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	5.05E-32	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	5.26E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	5.81E-10	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	7.28E-49	mr1798	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	1.28E-31	mr1878	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	4.96E-12	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	1.30E-15	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	1.40E-07	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	2.81E-31	mr1037_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	5.41E-64	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	9.50E-38	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	2.87E-28	mr1270_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	8.02E-13	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	2.42E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	3.40E-39	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435311304	NA	7.62E-32	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251