\
| Variant ID: vg0434849787 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 34849787 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCTTATAGCCTTTCTTTTATATATCATTCATACCACATCATCTCTGGTTTGAAATATATATTTGTTTGACAAATAAAATTGCTCCGTAATATTTAGCACG[G/A]
ACATATTTTTTTAAAGATCACCCGCGGGGGAGTACAAGTTTAGAAGTAGAGTGGGCAGAGGGAATACAACATATTAATTACAGGGAGCTGAGGGAGTTTA
TAAACTCCCTCAGCTCCCTGTAATTAATATGTTGTATTCCCTCTGCCCACTCTACTTCTAAACTTGTACTCCCCCGCGGGTGATCTTTAAAAAAATATGT[C/T]
CGTGCTAAATATTACGGAGCAATTTTATTTGTCAAACAAATATATATTTCAAACCAGAGATGATGTGGTATGAATGATATATAAAAGAAAGGCTATAAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.30% | 4.70% | 0.15% | 3.83% | NA |
| All Indica | 2759 | 98.20% | 1.30% | 0.07% | 0.43% | NA |
| All Japonica | 1512 | 88.60% | 0.00% | 0.33% | 11.04% | NA |
| Aus | 269 | 45.40% | 54.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.20% | 0.00% | 0.34% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.60% | 0.80% | 0.11% | 0.55% | NA |
| Indica Intermediate | 786 | 95.80% | 3.40% | 0.13% | 0.64% | NA |
| Temperate Japonica | 767 | 95.40% | 0.00% | 0.13% | 4.43% | NA |
| Tropical Japonica | 504 | 94.60% | 0.00% | 0.20% | 5.16% | NA |
| Japonica Intermediate | 241 | 54.40% | 0.00% | 1.24% | 44.40% | NA |
| VI/Aromatic | 96 | 67.70% | 32.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 8.90% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0434849787 | G -> DEL | N | N | silent_mutation | Average:34.26; most accessible tissue: Callus, score: 64.541 | N | N | N | N |
| vg0434849787 | G -> A | LOC_Os04g58610.1 | downstream_gene_variant ; 3180.0bp to feature; MODIFIER | silent_mutation | Average:34.26; most accessible tissue: Callus, score: 64.541 | N | N | N | N |
| vg0434849787 | G -> A | LOC_Os04g58600-LOC_Os04g58610 | intergenic_region ; MODIFIER | silent_mutation | Average:34.26; most accessible tissue: Callus, score: 64.541 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0434849787 | NA | 4.24E-07 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 9.25E-09 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 7.96E-07 | mr1007 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 7.29E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 7.97E-09 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 2.17E-07 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | 9.95E-06 | 2.62E-09 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 1.64E-16 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 5.50E-17 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | 5.63E-06 | 2.73E-23 | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 2.83E-09 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 3.26E-06 | mr1153 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 9.32E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 2.23E-16 | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 1.78E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 2.55E-21 | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 2.05E-07 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | 3.69E-06 | 1.55E-18 | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 1.68E-07 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 2.32E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 1.65E-06 | mr1288 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 8.53E-24 | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 1.56E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 3.60E-06 | mr1351 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | 8.27E-06 | 8.26E-06 | mr1357 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 2.15E-08 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 8.46E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 1.19E-06 | mr1397 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | 3.80E-06 | 3.37E-08 | mr1400 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 5.09E-06 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 8.71E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 3.59E-06 | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 6.83E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 3.21E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 1.22E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 5.82E-16 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 8.77E-11 | mr1499 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 3.34E-07 | mr1512 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 6.48E-12 | mr1522 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 9.93E-08 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | 6.60E-06 | 6.60E-06 | mr1605 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 7.10E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 3.27E-07 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 6.47E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 4.90E-06 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 2.74E-07 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 4.43E-07 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 8.72E-06 | mr1759 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 1.72E-10 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 1.00E-08 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 5.78E-11 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 7.21E-08 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 1.98E-09 | mr1939 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 8.93E-07 | mr1948 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | 6.56E-06 | 3.47E-07 | mr1960 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 7.14E-06 | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 8.48E-06 | mr1294_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | 7.44E-06 | 1.52E-06 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 9.15E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434849787 | NA | 1.66E-06 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |