Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434711477:

Variant ID: vg0434711477 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 34711477
Reference Allele: CAATGTATATCTTTATTATGTTTTATGATAT	Alternative Allele: TAATGTATATCTTTATTATGTTTTATGATAT,C
Primary Allele: CAATGTATATCTTTATTATG TTTTATGATAT	Secondary Allele: TAATGTATATCTTTATTATG TTTTATGATAT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATCATACAAACATGATATATCTTTACAGTTTTTATAATTTAAGAGCTTTTCAAATACAAACATGTTAAATTATCATCCAACATAATTACATAATGTTT[CAATGTATATCTTTATTATGTTTTATGATAT/TAATGTATATCTTTATTATGTTTTATGATAT,C]
CCTATATACTTATATAGTTCATTCTCACTTAGTTCTTAAATGATTAATCTATGGTCCAAATTATCTCTCTCTTTTTTTCCTCTAATTAAGTCATATCCCA

Reverse complement sequence

TGGGATATGACTTAATTAGAGGAAAAAAAGAGAGAGATAATTTGGACCATAGATTAATCATTTAAGAACTAAGTGAGAATGAACTATATAAGTATATAGG[ATATCATAAAACATAATAAAGATATACATTG/ATATCATAAAACATAATAAAGATATACATTA,G]
AAACATTATGTAATTATGTTGGATGATAATTTAACATGTTTGTATTTGAAAAGCTCTTAAATTATAAAAACTGTAAAGATATATCATGTTTGTATGATGT

Allele Frequencies:

Populations	Population Size	Frequency of CAATGTATATCTTTATTATG TTTTATGATAT(primary allele)	Frequency of TAATGTATATCTTTATTATG TTTTATGATAT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.50%	6.50%	13.80%	15.23%	C: 2.98%
All Indica	2759	48.20%	1.20%	22.04%	23.56%	C: 5.07%
All Japonica	1512	92.70%	1.90%	1.39%	4.03%	NA
Aus	269	16.00%	79.90%	4.09%	0.00%	NA
Indica I	595	39.80%	0.00%	36.30%	23.36%	C: 0.50%
Indica II	465	53.50%	0.60%	15.05%	26.88%	C: 3.87%
Indica III	913	43.20%	0.90%	19.82%	26.18%	C: 9.97%
Indica Intermediate	786	57.10%	2.70%	17.94%	18.70%	C: 3.56%
Temperate Japonica	767	98.30%	0.10%	0.39%	1.17%	NA
Tropical Japonica	504	90.90%	5.00%	2.38%	1.79%	NA
Japonica Intermediate	241	78.40%	1.20%	2.49%	17.84%	NA
VI/Aromatic	96	67.70%	27.10%	3.12%	2.08%	NA
Intermediate	90	74.40%	6.70%	10.00%	7.78%	C: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0434711477	CAATGTATATCTTTATTATGTTTTATGATAT -> C	LOC_Os04g58310.1	upstream_gene_variant ; 3524.0bp to feature; MODIFIER	silent_mutation	Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0434711477	CAATGTATATCTTTATTATGTTTTATGATAT -> C	LOC_Os04g58320.1	upstream_gene_variant ; 3241.0bp to feature; MODIFIER	silent_mutation	Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0434711477	CAATGTATATCTTTATTATGTTTTATGATAT -> C	LOC_Os04g58320.3	upstream_gene_variant ; 3241.0bp to feature; MODIFIER	silent_mutation	Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0434711477	CAATGTATATCTTTATTATGTTTTATGATAT -> C	LOC_Os04g58320.2	upstream_gene_variant ; 3241.0bp to feature; MODIFIER	silent_mutation	Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0434711477	CAATGTATATCTTTATTATGTTTTATGATAT -> C	LOC_Os04g58310-LOC_Os04g58320	intergenic_region ; MODIFIER	silent_mutation	Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0434711477	CAATGTATATCTTTATTATGTTTTATGATAT -> DEL	N	N	silent_mutation	Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0434711477	CAATGTATATCTTTATTATGTTTTATGATAT -> TAATGTATATCTTTATTATGTTTTATGATA T	LOC_Os04g58310.1	upstream_gene_variant ; 3523.0bp to feature; MODIFIER	silent_mutation	Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0434711477	CAATGTATATCTTTATTATGTTTTATGATAT -> TAATGTATATCTTTATTATGTTTTATGATA T	LOC_Os04g58320.1	upstream_gene_variant ; 3242.0bp to feature; MODIFIER	silent_mutation	Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0434711477	CAATGTATATCTTTATTATGTTTTATGATAT -> TAATGTATATCTTTATTATGTTTTATGATA T	LOC_Os04g58320.3	upstream_gene_variant ; 3242.0bp to feature; MODIFIER	silent_mutation	Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0434711477	CAATGTATATCTTTATTATGTTTTATGATAT -> TAATGTATATCTTTATTATGTTTTATGATA T	LOC_Os04g58320.2	upstream_gene_variant ; 3242.0bp to feature; MODIFIER	silent_mutation	Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0434711477	CAATGTATATCTTTATTATGTTTTATGATAT -> TAATGTATATCTTTATTATGTTTTATGATA T	LOC_Os04g58310-LOC_Os04g58320	intergenic_region ; MODIFIER	silent_mutation	Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0434711477	NA	4.38E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	3.05E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	8.40E-06	mr1054	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	8.12E-07	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	1.29E-13	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	3.91E-07	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	1.50E-23	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	5.63E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	1.45E-07	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	1.71E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	1.07E-27	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	2.94E-12	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	2.31E-12	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	6.42E-28	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	2.12E-12	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	9.73E-07	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	3.11E-09	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	1.16E-09	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	1.60E-07	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	3.75E-06	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	1.11E-06	1.29E-09	mr1906	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	1.22E-13	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	2.61E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	2.64E-10	mr1939	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	1.49E-06	mr1960	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	6.64E-21	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	3.17E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	7.82E-13	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	6.96E-16	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	3.29E-09	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	4.22E-06	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	2.99E-13	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477	NA	6.61E-08	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251