\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434711477:

Variant ID: vg0434711477 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 34711477
Reference Allele: CAATGTATATCTTTATTATGTTTTATGATATAlternative Allele: TAATGTATATCTTTATTATGTTTTATGATAT,C
Primary Allele: CAATGTATATCTTTATTATG TTTTATGATATSecondary Allele: TAATGTATATCTTTATTATG TTTTATGATAT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATCATACAAACATGATATATCTTTACAGTTTTTATAATTTAAGAGCTTTTCAAATACAAACATGTTAAATTATCATCCAACATAATTACATAATGTTT[CAATGTATATCTTTATTATGTTTTATGATAT/TAATGTATATCTTTATTATGTTTTATGATAT,C]
CCTATATACTTATATAGTTCATTCTCACTTAGTTCTTAAATGATTAATCTATGGTCCAAATTATCTCTCTCTTTTTTTCCTCTAATTAAGTCATATCCCA

Reverse complement sequence

TGGGATATGACTTAATTAGAGGAAAAAAAGAGAGAGATAATTTGGACCATAGATTAATCATTTAAGAACTAAGTGAGAATGAACTATATAAGTATATAGG[ATATCATAAAACATAATAAAGATATACATTG/ATATCATAAAACATAATAAAGATATACATTA,G]
AAACATTATGTAATTATGTTGGATGATAATTTAACATGTTTGTATTTGAAAAGCTCTTAAATTATAAAAACTGTAAAGATATATCATGTTTGTATGATGT

Allele Frequencies:

Populations Population SizeFrequency of CAATGTATATCTTTATTATG TTTTATGATAT(primary allele) Frequency of TAATGTATATCTTTATTATG TTTTATGATAT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 6.50% 13.80% 15.23% C: 2.98%
All Indica  2759 48.20% 1.20% 22.04% 23.56% C: 5.07%
All Japonica  1512 92.70% 1.90% 1.39% 4.03% NA
Aus  269 16.00% 79.90% 4.09% 0.00% NA
Indica I  595 39.80% 0.00% 36.30% 23.36% C: 0.50%
Indica II  465 53.50% 0.60% 15.05% 26.88% C: 3.87%
Indica III  913 43.20% 0.90% 19.82% 26.18% C: 9.97%
Indica Intermediate  786 57.10% 2.70% 17.94% 18.70% C: 3.56%
Temperate Japonica  767 98.30% 0.10% 0.39% 1.17% NA
Tropical Japonica  504 90.90% 5.00% 2.38% 1.79% NA
Japonica Intermediate  241 78.40% 1.20% 2.49% 17.84% NA
VI/Aromatic  96 67.70% 27.10% 3.12% 2.08% NA
Intermediate  90 74.40% 6.70% 10.00% 7.78% C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434711477 CAATGTATATCTTTATTATGTTTTATGATAT -> C LOC_Os04g58310.1 upstream_gene_variant ; 3524.0bp to feature; MODIFIER silent_mutation Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0434711477 CAATGTATATCTTTATTATGTTTTATGATAT -> C LOC_Os04g58320.1 upstream_gene_variant ; 3241.0bp to feature; MODIFIER silent_mutation Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0434711477 CAATGTATATCTTTATTATGTTTTATGATAT -> C LOC_Os04g58320.3 upstream_gene_variant ; 3241.0bp to feature; MODIFIER silent_mutation Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0434711477 CAATGTATATCTTTATTATGTTTTATGATAT -> C LOC_Os04g58320.2 upstream_gene_variant ; 3241.0bp to feature; MODIFIER silent_mutation Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0434711477 CAATGTATATCTTTATTATGTTTTATGATAT -> C LOC_Os04g58310-LOC_Os04g58320 intergenic_region ; MODIFIER silent_mutation Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0434711477 CAATGTATATCTTTATTATGTTTTATGATAT -> DEL N N silent_mutation Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0434711477 CAATGTATATCTTTATTATGTTTTATGATAT -> TAATGTATATCTTTATTATGTTTTATGATA T LOC_Os04g58310.1 upstream_gene_variant ; 3523.0bp to feature; MODIFIER silent_mutation Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0434711477 CAATGTATATCTTTATTATGTTTTATGATAT -> TAATGTATATCTTTATTATGTTTTATGATA T LOC_Os04g58320.1 upstream_gene_variant ; 3242.0bp to feature; MODIFIER silent_mutation Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0434711477 CAATGTATATCTTTATTATGTTTTATGATAT -> TAATGTATATCTTTATTATGTTTTATGATA T LOC_Os04g58320.3 upstream_gene_variant ; 3242.0bp to feature; MODIFIER silent_mutation Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0434711477 CAATGTATATCTTTATTATGTTTTATGATAT -> TAATGTATATCTTTATTATGTTTTATGATA T LOC_Os04g58320.2 upstream_gene_variant ; 3242.0bp to feature; MODIFIER silent_mutation Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0434711477 CAATGTATATCTTTATTATGTTTTATGATAT -> TAATGTATATCTTTATTATGTTTTATGATA T LOC_Os04g58310-LOC_Os04g58320 intergenic_region ; MODIFIER silent_mutation Average:33.888; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434711477 NA 4.38E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 3.05E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 8.40E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 8.12E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 1.29E-13 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 3.91E-07 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 1.50E-23 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 5.63E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 1.45E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 1.71E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 1.07E-27 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 2.94E-12 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 2.31E-12 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 6.42E-28 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 2.12E-12 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 9.73E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 3.11E-09 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 1.16E-09 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 1.60E-07 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 3.75E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 1.11E-06 1.29E-09 mr1906 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 1.22E-13 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 2.61E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 2.64E-10 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 1.49E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 6.64E-21 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 3.17E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 7.82E-13 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 6.96E-16 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 3.29E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 4.22E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 2.99E-13 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434711477 NA 6.61E-08 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251