Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434567760:

Variant ID: vg0434567760 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 34567760
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.09, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TCCCTAACAAATAAATCAATCCAAACGTATATGACGGATCTACCTTCTATGACAGATAAGTAAAAAGCAAGGAAATAAAATTACTACTTCCTCTGTTTTA[T/C]
AATGTAAGTCATTTTAGTATTTCCCACATTCATAGTGATGTTAATGAATCTAGATAAACATATATGTCTAGATTTATTAGCATCAATATGAATATGGAAA

Reverse complement sequence

TTTCCATATTCATATTGATGCTAATAAATCTAGACATATATGTTTATCTAGATTCATTAACATCACTATGAATGTGGGAAATACTAAAATGACTTACATT[A/G]
TAAAACAGAGGAAGTAGTAATTTTATTTCCTTGCTTTTTACTTATCTGTCATAGAAGGTAGATCCGTCATATACGTTTGGATTGATTTATTTGTTAGGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.70%	42.60%	0.02%	0.66%	NA
All Indica	2759	94.70%	4.40%	0.04%	0.87%	NA
All Japonica	1512	1.30%	98.30%	0.00%	0.33%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	97.00%	1.80%	0.00%	1.18%	NA
Indica II	465	96.60%	2.20%	0.00%	1.29%	NA
Indica III	913	98.20%	1.50%	0.11%	0.11%	NA
Indica Intermediate	786	87.70%	11.10%	0.00%	1.27%	NA
Temperate Japonica	767	0.50%	99.20%	0.00%	0.26%	NA
Tropical Japonica	504	2.60%	97.00%	0.00%	0.40%	NA
Japonica Intermediate	241	1.20%	98.30%	0.00%	0.41%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	46.70%	51.10%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0434567760	T -> C	LOC_Os04g58030.1	upstream_gene_variant ; 1700.0bp to feature; MODIFIER	silent_mutation	Average:42.573; most accessible tissue: Callus, score: 69.327	N	N	N	N
vg0434567760	T -> C	LOC_Os04g58040.1	intron_variant ; MODIFIER	silent_mutation	Average:42.573; most accessible tissue: Callus, score: 69.327	N	N	N	N
vg0434567760	T -> DEL	N	N	silent_mutation	Average:42.573; most accessible tissue: Callus, score: 69.327	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0434567760	NA	1.03E-13	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	7.75E-50	mr1125	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	1.99E-44	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	2.74E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	7.81E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	2.42E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	4.65E-64	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	1.03E-14	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	6.21E-13	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	8.91E-23	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	1.88E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	1.37E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	9.36E-11	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	4.61E-10	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	3.43E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	1.67E-23	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	1.15E-07	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	1.40E-47	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	6.50E-13	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	1.55E-31	mr1571_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	2.86E-29	mr1580_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	5.30E-13	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	3.37E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	5.75E-29	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	1.33E-21	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	1.27E-24	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	1.07E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760	NA	5.70E-31	mr1943_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251