\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434567760:

Variant ID: vg0434567760 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34567760
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.09, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCTAACAAATAAATCAATCCAAACGTATATGACGGATCTACCTTCTATGACAGATAAGTAAAAAGCAAGGAAATAAAATTACTACTTCCTCTGTTTTA[T/C]
AATGTAAGTCATTTTAGTATTTCCCACATTCATAGTGATGTTAATGAATCTAGATAAACATATATGTCTAGATTTATTAGCATCAATATGAATATGGAAA

Reverse complement sequence

TTTCCATATTCATATTGATGCTAATAAATCTAGACATATATGTTTATCTAGATTCATTAACATCACTATGAATGTGGGAAATACTAAAATGACTTACATT[A/G]
TAAAACAGAGGAAGTAGTAATTTTATTTCCTTGCTTTTTACTTATCTGTCATAGAAGGTAGATCCGTCATATACGTTTGGATTGATTTATTTGTTAGGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.70% 42.60% 0.02% 0.66% NA
All Indica  2759 94.70% 4.40% 0.04% 0.87% NA
All Japonica  1512 1.30% 98.30% 0.00% 0.33% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 97.00% 1.80% 0.00% 1.18% NA
Indica II  465 96.60% 2.20% 0.00% 1.29% NA
Indica III  913 98.20% 1.50% 0.11% 0.11% NA
Indica Intermediate  786 87.70% 11.10% 0.00% 1.27% NA
Temperate Japonica  767 0.50% 99.20% 0.00% 0.26% NA
Tropical Japonica  504 2.60% 97.00% 0.00% 0.40% NA
Japonica Intermediate  241 1.20% 98.30% 0.00% 0.41% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 46.70% 51.10% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434567760 T -> C LOC_Os04g58030.1 upstream_gene_variant ; 1700.0bp to feature; MODIFIER silent_mutation Average:42.573; most accessible tissue: Callus, score: 69.327 N N N N
vg0434567760 T -> C LOC_Os04g58040.1 intron_variant ; MODIFIER silent_mutation Average:42.573; most accessible tissue: Callus, score: 69.327 N N N N
vg0434567760 T -> DEL N N silent_mutation Average:42.573; most accessible tissue: Callus, score: 69.327 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434567760 NA 1.03E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 7.75E-50 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 1.99E-44 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 2.74E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 7.81E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 2.42E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 4.65E-64 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 1.03E-14 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 6.21E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 8.91E-23 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 1.88E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 1.37E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 9.36E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 4.61E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 3.43E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 1.67E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 1.15E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 1.40E-47 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 6.50E-13 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 1.55E-31 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 2.86E-29 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 5.30E-13 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 3.37E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 5.75E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 1.33E-21 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 1.27E-24 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 1.07E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434567760 NA 5.70E-31 mr1943_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251