\
| Variant ID: vg0434551164 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 34551164 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 101. )
TCTCGTTTCTCCCCCAGCTTCCTTTTCCCAACAAGCCAAAACACCAAGCCACCGTACAAATGAGAGAGGAGGCCGCGGGCGGATCTGGCAGCGGTGATGG[T/C]
GGCCCTCGCGAACGCACACGGATCTGATGGTGGAGGTGCTCGCGGAAGAAGGCCACAGCAGCGGTAGATTTGGCGACGGCGGCATCTCGCATGGATCTGT
ACAGATCCATGCGAGATGCCGCCGTCGCCAAATCTACCGCTGCTGTGGCCTTCTTCCGCGAGCACCTCCACCATCAGATCCGTGTGCGTTCGCGAGGGCC[A/G]
CCATCACCGCTGCCAGATCCGCCCGCGGCCTCCTCTCTCATTTGTACGGTGGCTTGGTGTTTTGGCTTGTTGGGAAAAGGAAGCTGGGGGAGAAACGAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.00% | 38.30% | 0.00% | 0.68% | NA |
| All Indica | 2759 | 96.30% | 2.80% | 0.00% | 0.91% | NA |
| All Japonica | 1512 | 11.60% | 88.10% | 0.00% | 0.33% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 1.00% | 0.00% | 1.18% | NA |
| Indica II | 465 | 97.40% | 1.10% | 0.00% | 1.51% | NA |
| Indica III | 913 | 98.60% | 1.30% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 92.00% | 6.70% | 0.00% | 1.27% | NA |
| Temperate Japonica | 767 | 4.40% | 95.30% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 6.90% | 92.70% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 44.00% | 55.60% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 51.10% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0434551164 | T -> C | LOC_Os04g58010.1 | missense_variant ; p.Thr275Ala; MODERATE | nonsynonymous_codon ; T275A | Average:56.144; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | unknown | unknown | TOLERATED | 0.73 |
| vg0434551164 | T -> DEL | LOC_Os04g58010.1 | N | frameshift_variant | Average:56.144; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0434551164 | NA | 2.26E-14 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | NA | 9.05E-13 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | NA | 3.01E-27 | mr1037 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | NA | 2.70E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | NA | 6.03E-41 | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | NA | 3.92E-23 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | NA | 5.83E-06 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | 2.31E-06 | NA | mr1693 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | NA | 9.26E-10 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | NA | 1.40E-31 | mr1037_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | NA | 1.48E-21 | mr1164_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | NA | 1.77E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | NA | 1.65E-43 | mr1509_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | NA | 5.67E-35 | mr1571_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | NA | 1.47E-30 | mr1580_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | NA | 2.27E-30 | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434551164 | NA | 2.54E-27 | mr1943_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |