\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434433851:

Variant ID: vg0434433851 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34433851
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


CGTCATATAATATAAAGGATTTTGAGTGGATGCGACACATCCTACTGTAATGAATGTACTCGTCTGTACAGATTCATGGTATTAGGATGCGTCGCATCCA[C/T]
ATAAAATCCCTTATATTATAGAACGAAATGAGTACTAATGATATTGAAGTTTGTCTGGACTAAAAAAAATCTTTCTAGCTCCGTCACTGCATCCATCCAC

Reverse complement sequence

GTGGATGGATGCAGTGACGGAGCTAGAAAGATTTTTTTTAGTCCAGACAAACTTCAATATCATTAGTACTCATTTCGTTCTATAATATAAGGGATTTTAT[G/A]
TGGATGCGACGCATCCTAATACCATGAATCTGTACAGACGAGTACATTCATTACAGTAGGATGTGTCGCATCCACTCAAAATCCTTTATATTATATGACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.20% 42.30% 0.36% 0.15% NA
All Indica  2759 95.40% 4.00% 0.54% 0.11% NA
All Japonica  1512 1.80% 97.90% 0.07% 0.20% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 91.60% 7.90% 0.50% 0.00% NA
Indica II  465 97.60% 1.10% 1.08% 0.22% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 93.50% 5.30% 0.89% 0.25% NA
Temperate Japonica  767 0.70% 99.20% 0.00% 0.13% NA
Tropical Japonica  504 3.80% 95.80% 0.20% 0.20% NA
Japonica Intermediate  241 1.20% 98.30% 0.00% 0.41% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 41.10% 56.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434433851 C -> DEL N N silent_mutation Average:78.513; most accessible tissue: Minghui63 flower, score: 90.004 N N N N
vg0434433851 C -> T LOC_Os04g57830.1 upstream_gene_variant ; 2807.0bp to feature; MODIFIER silent_mutation Average:78.513; most accessible tissue: Minghui63 flower, score: 90.004 N N N N
vg0434433851 C -> T LOC_Os04g57819.2 downstream_gene_variant ; 2183.0bp to feature; MODIFIER silent_mutation Average:78.513; most accessible tissue: Minghui63 flower, score: 90.004 N N N N
vg0434433851 C -> T LOC_Os04g57819.1 downstream_gene_variant ; 2183.0bp to feature; MODIFIER silent_mutation Average:78.513; most accessible tissue: Minghui63 flower, score: 90.004 N N N N
vg0434433851 C -> T LOC_Os04g57819-LOC_Os04g57830 intergenic_region ; MODIFIER silent_mutation Average:78.513; most accessible tissue: Minghui63 flower, score: 90.004 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0434433851 C T 0.0 -0.06 -0.08 -0.04 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434433851 NA 2.92E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 1.05E-47 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 5.31E-54 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 3.63E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 1.18E-30 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 1.11E-31 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 1.34E-30 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 4.57E-44 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 4.10E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 1.18E-58 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 8.37E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 6.41E-40 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 1.83E-31 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 1.14E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 1.82E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 7.57E-70 mr1125_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 1.26E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 4.05E-25 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 1.90E-50 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 9.68E-44 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 1.46E-59 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 1.23E-38 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434433851 NA 5.37E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251