| Variant ID: vg0434012329 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 34012329 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, G: 0.35, others allele: 0.00, population size: 69. )
AGTTAGTGTGGTGTGGTTCAGGATTGTACTGGTGGTGGTGGGGTGGGTGGAATGGTTCTTGGTGGTAATAAGGATTGTATGGTTGGTGGTATGGTTCAGG[A/G]
TGAGCACCATGTCCCCCTTCCCAGAAGTGAGTAGGTGTAGATGATATAGGGGGTACATGAGGTGGTGGGTTTGGGTAGTAGTGGTAATCCCAAGGAACCG
CGGTTCCTTGGGATTACCACTACTACCCAAACCCACCACCTCATGTACCCCCTATATCATCTACACCTACTCACTTCTGGGAAGGGGGACATGGTGCTCA[T/C]
CCTGAACCATACCACCAACCATACAATCCTTATTACCACCAAGAACCATTCCACCCACCCCACCACCACCAGTACAATCCTGAACCACACCACACTAACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.00% | 13.50% | 1.46% | 63.99% | NA |
| All Indica | 2759 | 6.20% | 22.40% | 1.52% | 69.95% | NA |
| All Japonica | 1512 | 41.00% | 0.60% | 0.99% | 57.41% | NA |
| Aus | 269 | 57.60% | 0.40% | 3.35% | 38.66% | NA |
| Indica I | 595 | 5.40% | 6.10% | 2.52% | 86.05% | NA |
| Indica II | 465 | 3.20% | 38.50% | 1.51% | 56.77% | NA |
| Indica III | 913 | 5.60% | 22.80% | 1.10% | 70.54% | NA |
| Indica Intermediate | 786 | 9.20% | 24.70% | 1.27% | 64.89% | NA |
| Temperate Japonica | 767 | 72.20% | 0.10% | 0.52% | 27.12% | NA |
| Tropical Japonica | 504 | 4.40% | 1.20% | 1.39% | 93.06% | NA |
| Japonica Intermediate | 241 | 18.30% | 0.80% | 1.66% | 79.25% | NA |
| VI/Aromatic | 96 | 20.80% | 2.10% | 2.08% | 75.00% | NA |
| Intermediate | 90 | 32.20% | 11.10% | 1.11% | 55.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0434012329 | A -> DEL | N | N | silent_mutation | Average:14.862; most accessible tissue: Callus, score: 36.91 | N | N | N | N |
| vg0434012329 | A -> G | LOC_Os04g57060.1 | 5_prime_UTR_variant ; 1357.0bp to feature; MODIFIER | silent_mutation | Average:14.862; most accessible tissue: Callus, score: 36.91 | N | N | N | N |
| vg0434012329 | A -> G | LOC_Os04g57070.1 | upstream_gene_variant ; 1761.0bp to feature; MODIFIER | silent_mutation | Average:14.862; most accessible tissue: Callus, score: 36.91 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0434012329 | NA | 3.73E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434012329 | NA | 5.52E-06 | mr1046 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434012329 | NA | 6.29E-06 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434012329 | NA | 1.18E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434012329 | NA | 1.19E-06 | mr1057 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434012329 | 2.49E-06 | 7.42E-08 | mr1311 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434012329 | NA | 5.58E-06 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434012329 | NA | 8.21E-06 | mr1603 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434012329 | NA | 7.76E-06 | mr1603 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |