\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434012329:

Variant ID: vg0434012329 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34012329
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, G: 0.35, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTAGTGTGGTGTGGTTCAGGATTGTACTGGTGGTGGTGGGGTGGGTGGAATGGTTCTTGGTGGTAATAAGGATTGTATGGTTGGTGGTATGGTTCAGG[A/G]
TGAGCACCATGTCCCCCTTCCCAGAAGTGAGTAGGTGTAGATGATATAGGGGGTACATGAGGTGGTGGGTTTGGGTAGTAGTGGTAATCCCAAGGAACCG

Reverse complement sequence

CGGTTCCTTGGGATTACCACTACTACCCAAACCCACCACCTCATGTACCCCCTATATCATCTACACCTACTCACTTCTGGGAAGGGGGACATGGTGCTCA[T/C]
CCTGAACCATACCACCAACCATACAATCCTTATTACCACCAAGAACCATTCCACCCACCCCACCACCACCAGTACAATCCTGAACCACACCACACTAACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.00% 13.50% 1.46% 63.99% NA
All Indica  2759 6.20% 22.40% 1.52% 69.95% NA
All Japonica  1512 41.00% 0.60% 0.99% 57.41% NA
Aus  269 57.60% 0.40% 3.35% 38.66% NA
Indica I  595 5.40% 6.10% 2.52% 86.05% NA
Indica II  465 3.20% 38.50% 1.51% 56.77% NA
Indica III  913 5.60% 22.80% 1.10% 70.54% NA
Indica Intermediate  786 9.20% 24.70% 1.27% 64.89% NA
Temperate Japonica  767 72.20% 0.10% 0.52% 27.12% NA
Tropical Japonica  504 4.40% 1.20% 1.39% 93.06% NA
Japonica Intermediate  241 18.30% 0.80% 1.66% 79.25% NA
VI/Aromatic  96 20.80% 2.10% 2.08% 75.00% NA
Intermediate  90 32.20% 11.10% 1.11% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434012329 A -> DEL N N silent_mutation Average:14.862; most accessible tissue: Callus, score: 36.91 N N N N
vg0434012329 A -> G LOC_Os04g57060.1 5_prime_UTR_variant ; 1357.0bp to feature; MODIFIER silent_mutation Average:14.862; most accessible tissue: Callus, score: 36.91 N N N N
vg0434012329 A -> G LOC_Os04g57070.1 upstream_gene_variant ; 1761.0bp to feature; MODIFIER silent_mutation Average:14.862; most accessible tissue: Callus, score: 36.91 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434012329 NA 3.73E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434012329 NA 5.52E-06 mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434012329 NA 6.29E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434012329 NA 1.18E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434012329 NA 1.19E-06 mr1057 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434012329 2.49E-06 7.42E-08 mr1311 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434012329 NA 5.58E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434012329 NA 8.21E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434012329 NA 7.76E-06 mr1603 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251