Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433908182:

Variant ID: vg0433908182 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 33908182
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

AGACTAGGGCGGCATTGAGCTCGCTAGATCCATCCTCGAACGGTGGCGACGACGATGGTTCCTTCCTCCTTTCTCCCAATCTTTGTCTCTCCCTGCAGGC[C/T]
GCTGACGCCGCCCCGTCGAGCGCGAGTGATGACTATGACGGCGGCACTAGCCTCCTCTTCTCCTCCCCCGCTCTCCCCTCCTCTTCCGAGCCGTCGGCTA

Reverse complement sequence

TAGCCGACGGCTCGGAAGAGGAGGGGAGAGCGGGGGAGGAGAAGAGGAGGCTAGTGCCGCCGTCATAGTCATCACTCGCGCTCGACGGGGCGGCGTCAGC[G/A]
GCCTGCAGGGAGAGACAAAGATTGGGAGAAAGGAGGAAGGAACCATCGTCGTCGCCACCGTTCGAGGATGGATCTAGCGAGCTCAATGCCGCCCTAGTCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.10%	32.30%	0.63%	0.00%	NA
All Indica	2759	97.60%	1.70%	0.69%	0.00%	NA
All Japonica	1512	17.90%	81.70%	0.40%	0.00%	NA
Aus	269	41.30%	58.00%	0.74%	0.00%	NA
Indica I	595	98.30%	1.00%	0.67%	0.00%	NA
Indica II	465	98.70%	0.60%	0.65%	0.00%	NA
Indica III	913	98.90%	0.90%	0.22%	0.00%	NA
Indica Intermediate	786	95.00%	3.70%	1.27%	0.00%	NA
Temperate Japonica	767	1.20%	98.30%	0.52%	0.00%	NA
Tropical Japonica	504	47.60%	52.00%	0.40%	0.00%	NA
Japonica Intermediate	241	9.10%	90.90%	0.00%	0.00%	NA
VI/Aromatic	96	46.90%	53.10%	0.00%	0.00%	NA
Intermediate	90	53.30%	43.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0433908182	C -> T	LOC_Os04g56870.1	upstream_gene_variant ; 4939.0bp to feature; MODIFIER	silent_mutation	Average:57.521; most accessible tissue: Zhenshan97 young leaf, score: 81.841	N	N	N	N
vg0433908182	C -> T	LOC_Os04g56880.1	upstream_gene_variant ; 2175.0bp to feature; MODIFIER	silent_mutation	Average:57.521; most accessible tissue: Zhenshan97 young leaf, score: 81.841	N	N	N	N
vg0433908182	C -> T	LOC_Os04g56890.1	downstream_gene_variant ; 384.0bp to feature; MODIFIER	silent_mutation	Average:57.521; most accessible tissue: Zhenshan97 young leaf, score: 81.841	N	N	N	N
vg0433908182	C -> T	LOC_Os04g56880-LOC_Os04g56890	intergenic_region ; MODIFIER	silent_mutation	Average:57.521; most accessible tissue: Zhenshan97 young leaf, score: 81.841	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0433908182	NA	2.28E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	NA	3.72E-16	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	NA	4.52E-13	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	NA	2.06E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	NA	7.73E-08	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	1.41E-06	1.48E-09	mr1040	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	NA	5.22E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	NA	3.25E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	NA	5.38E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	NA	2.66E-16	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	NA	1.61E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	NA	1.39E-18	mr1179	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	NA	3.71E-06	mr1378	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	NA	1.01E-20	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	NA	4.59E-08	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	NA	3.01E-08	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182	NA	1.85E-07	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251