\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433908182:

Variant ID: vg0433908182 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33908182
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AGACTAGGGCGGCATTGAGCTCGCTAGATCCATCCTCGAACGGTGGCGACGACGATGGTTCCTTCCTCCTTTCTCCCAATCTTTGTCTCTCCCTGCAGGC[C/T]
GCTGACGCCGCCCCGTCGAGCGCGAGTGATGACTATGACGGCGGCACTAGCCTCCTCTTCTCCTCCCCCGCTCTCCCCTCCTCTTCCGAGCCGTCGGCTA

Reverse complement sequence

TAGCCGACGGCTCGGAAGAGGAGGGGAGAGCGGGGGAGGAGAAGAGGAGGCTAGTGCCGCCGTCATAGTCATCACTCGCGCTCGACGGGGCGGCGTCAGC[G/A]
GCCTGCAGGGAGAGACAAAGATTGGGAGAAAGGAGGAAGGAACCATCGTCGTCGCCACCGTTCGAGGATGGATCTAGCGAGCTCAATGCCGCCCTAGTCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 32.30% 0.63% 0.00% NA
All Indica  2759 97.60% 1.70% 0.69% 0.00% NA
All Japonica  1512 17.90% 81.70% 0.40% 0.00% NA
Aus  269 41.30% 58.00% 0.74% 0.00% NA
Indica I  595 98.30% 1.00% 0.67% 0.00% NA
Indica II  465 98.70% 0.60% 0.65% 0.00% NA
Indica III  913 98.90% 0.90% 0.22% 0.00% NA
Indica Intermediate  786 95.00% 3.70% 1.27% 0.00% NA
Temperate Japonica  767 1.20% 98.30% 0.52% 0.00% NA
Tropical Japonica  504 47.60% 52.00% 0.40% 0.00% NA
Japonica Intermediate  241 9.10% 90.90% 0.00% 0.00% NA
VI/Aromatic  96 46.90% 53.10% 0.00% 0.00% NA
Intermediate  90 53.30% 43.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433908182 C -> T LOC_Os04g56870.1 upstream_gene_variant ; 4939.0bp to feature; MODIFIER silent_mutation Average:57.521; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg0433908182 C -> T LOC_Os04g56880.1 upstream_gene_variant ; 2175.0bp to feature; MODIFIER silent_mutation Average:57.521; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg0433908182 C -> T LOC_Os04g56890.1 downstream_gene_variant ; 384.0bp to feature; MODIFIER silent_mutation Average:57.521; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg0433908182 C -> T LOC_Os04g56880-LOC_Os04g56890 intergenic_region ; MODIFIER silent_mutation Average:57.521; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433908182 NA 2.28E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 NA 3.72E-16 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 NA 4.52E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 NA 2.06E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 NA 7.73E-08 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 1.41E-06 1.48E-09 mr1040 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 NA 5.22E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 NA 3.25E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 NA 5.38E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 NA 2.66E-16 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 NA 1.61E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 NA 1.39E-18 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 NA 3.71E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 NA 1.01E-20 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 NA 4.59E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 NA 3.01E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433908182 NA 1.85E-07 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251