Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433627526:

Variant ID: vg0433627526 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 33627526
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

TAGGTGTAAAAATTTTGAAGTATATGAACACACATTTGAAGGAATTAAACGTAGTCCAATAATAAAACAAATTACAGATGCTGCCAGGAAACTACGAGAC[G/A]
AATTTATTAAGCCTAATTAATCTGTTATTAGCAAATGTTTACTGTAGCATCATATTGTAAAATCATGGCGTAATTAGGCTCAAAAGATTCGTCTCGCAAT

Reverse complement sequence

ATTGCGAGACGAATCTTTTGAGCCTAATTACGCCATGATTTTACAATATGATGCTACAGTAAACATTTGCTAATAACAGATTAATTAGGCTTAATAAATT[C/T]
GTCTCGTAGTTTCCTGGCAGCATCTGTAATTTGTTTTATTATTGGACTACGTTTAATTCCTTCAAATGTGTGTTCATATACTTCAAAATTTTTACACCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.90%	48.60%	0.47%	0.00%	NA
All Indica	2759	76.10%	23.30%	0.62%	0.00%	NA
All Japonica	1512	17.50%	82.30%	0.13%	0.00%	NA
Aus	269	3.30%	96.70%	0.00%	0.00%	NA
Indica I	595	87.10%	11.90%	1.01%	0.00%	NA
Indica II	465	80.00%	19.60%	0.43%	0.00%	NA
Indica III	913	71.60%	28.00%	0.33%	0.00%	NA
Indica Intermediate	786	70.70%	28.50%	0.76%	0.00%	NA
Temperate Japonica	767	0.80%	99.20%	0.00%	0.00%	NA
Tropical Japonica	504	48.60%	51.00%	0.40%	0.00%	NA
Japonica Intermediate	241	5.80%	94.20%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	33.30%	63.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0433627526	G -> A	LOC_Os04g56390.1	downstream_gene_variant ; 3595.0bp to feature; MODIFIER	silent_mutation	Average:35.033; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg0433627526	G -> A	LOC_Os04g56405.1	downstream_gene_variant ; 4164.0bp to feature; MODIFIER	silent_mutation	Average:35.033; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg0433627526	G -> A	LOC_Os04g56400.3	downstream_gene_variant ; 383.0bp to feature; MODIFIER	silent_mutation	Average:35.033; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg0433627526	G -> A	LOC_Os04g56400.4	downstream_gene_variant ; 383.0bp to feature; MODIFIER	silent_mutation	Average:35.033; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg0433627526	G -> A	LOC_Os04g56400.1	intron_variant ; MODIFIER	silent_mutation	Average:35.033; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0433627526	NA	3.76E-06	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	4.46E-06	mr1550	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	2.45E-10	mr1624	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	4.12E-06	mr1713	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	1.65E-06	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	2.16E-16	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	3.38E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	1.73E-06	mr1943	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	4.28E-06	4.28E-06	mr1217_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	1.08E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	9.19E-06	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	1.74E-06	mr1318_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	7.26E-06	7.26E-06	mr1596_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	1.38E-08	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	6.67E-08	mr1713_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	1.46E-06	mr1729_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	4.11E-06	mr1740_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	1.69E-06	mr1788_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	1.72E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	8.68E-14	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526	NA	1.59E-06	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251