\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433627526:

Variant ID: vg0433627526 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33627526
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


TAGGTGTAAAAATTTTGAAGTATATGAACACACATTTGAAGGAATTAAACGTAGTCCAATAATAAAACAAATTACAGATGCTGCCAGGAAACTACGAGAC[G/A]
AATTTATTAAGCCTAATTAATCTGTTATTAGCAAATGTTTACTGTAGCATCATATTGTAAAATCATGGCGTAATTAGGCTCAAAAGATTCGTCTCGCAAT

Reverse complement sequence

ATTGCGAGACGAATCTTTTGAGCCTAATTACGCCATGATTTTACAATATGATGCTACAGTAAACATTTGCTAATAACAGATTAATTAGGCTTAATAAATT[C/T]
GTCTCGTAGTTTCCTGGCAGCATCTGTAATTTGTTTTATTATTGGACTACGTTTAATTCCTTCAAATGTGTGTTCATATACTTCAAAATTTTTACACCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 48.60% 0.47% 0.00% NA
All Indica  2759 76.10% 23.30% 0.62% 0.00% NA
All Japonica  1512 17.50% 82.30% 0.13% 0.00% NA
Aus  269 3.30% 96.70% 0.00% 0.00% NA
Indica I  595 87.10% 11.90% 1.01% 0.00% NA
Indica II  465 80.00% 19.60% 0.43% 0.00% NA
Indica III  913 71.60% 28.00% 0.33% 0.00% NA
Indica Intermediate  786 70.70% 28.50% 0.76% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 48.60% 51.00% 0.40% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 33.30% 63.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433627526 G -> A LOC_Os04g56390.1 downstream_gene_variant ; 3595.0bp to feature; MODIFIER silent_mutation Average:35.033; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg0433627526 G -> A LOC_Os04g56405.1 downstream_gene_variant ; 4164.0bp to feature; MODIFIER silent_mutation Average:35.033; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg0433627526 G -> A LOC_Os04g56400.3 downstream_gene_variant ; 383.0bp to feature; MODIFIER silent_mutation Average:35.033; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg0433627526 G -> A LOC_Os04g56400.4 downstream_gene_variant ; 383.0bp to feature; MODIFIER silent_mutation Average:35.033; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg0433627526 G -> A LOC_Os04g56400.1 intron_variant ; MODIFIER silent_mutation Average:35.033; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433627526 NA 3.76E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 4.46E-06 mr1550 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 2.45E-10 mr1624 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 4.12E-06 mr1713 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 1.65E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 2.16E-16 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 3.38E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 1.73E-06 mr1943 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 4.28E-06 4.28E-06 mr1217_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 1.08E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 9.19E-06 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 1.74E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 7.26E-06 7.26E-06 mr1596_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 1.38E-08 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 6.67E-08 mr1713_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 1.46E-06 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 4.11E-06 mr1740_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 1.69E-06 mr1788_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 1.72E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 8.68E-14 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433627526 NA 1.59E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251