Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0433048756:

Variant ID: vg0433048756 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33048756
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCTATTATCACCAAATTATTACAACAAAAAATAATTCATAGCAATATATTGTACTATTGCAACGATAATTTTTCTGTAGCAAATAATTATATTTTAATG[G/C]
AACGATATACAATCGTTGTTTTATTTAGTACTTTTGTTGCAATAGAAAATGAGATATCGCTAAAAAAAATCGTATTGTTGCAAAAAAACATGTTCTATCG

Reverse complement sequence

CGATAGAACATGTTTTTTTGCAACAATACGATTTTTTTTAGCGATATCTCATTTTCTATTGCAACAAAAGTACTAAATAAAACAACGATTGTATATCGTT[C/G]
CATTAAAATATAATTATTTGCTACAGAAAAATTATCGTTGCAATAGTACAATATATTGCTATGAATTATTTTTTGTTGTAATAATTTGGTGATAATAGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.00% 14.40% 0.63% 0.00% NA
All Indica  2759 99.40% 0.50% 0.04% 0.00% NA
All Japonica  1512 55.80% 42.40% 1.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.20% 1.70% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 22.30% 74.60% 3.13% 0.00% NA
Tropical Japonica  504 97.00% 3.00% 0.00% 0.00% NA
Japonica Intermediate  241 76.30% 22.40% 1.24% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 81.10% 16.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433048756 G -> C LOC_Os04g55540.1 upstream_gene_variant ; 4605.0bp to feature; MODIFIER silent_mutation Average:75.942; most accessible tissue: Minghui63 panicle, score: 95.757 N N N N
vg0433048756 G -> C LOC_Os04g55550.1 upstream_gene_variant ; 4280.0bp to feature; MODIFIER silent_mutation Average:75.942; most accessible tissue: Minghui63 panicle, score: 95.757 N N N N
vg0433048756 G -> C LOC_Os04g55540-LOC_Os04g55550 intergenic_region ; MODIFIER silent_mutation Average:75.942; most accessible tissue: Minghui63 panicle, score: 95.757 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0433048756 G C -0.02 -0.02 0.0 0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433048756 NA 2.34E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 2.78E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 1.07E-12 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 3.31E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 1.95E-06 2.85E-24 mr1115 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 1.88E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 2.69E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 8.30E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 9.69E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 2.95E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 1.52E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 8.41E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 5.27E-17 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 2.92E-18 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 6.57E-09 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 1.37E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 1.98E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433048756 NA 4.37E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251