\
| Variant ID: vg0433018887 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 33018887 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.07, others allele: 0.00, population size: 209. )
TTTTAATCACCTCAATCTCTTTCTTCTTTACCCTTCCCTCTCTCACTCCGCTGCAACACTGACAAAAAGCAATGCACAGGCGCCTAGGAGCTCGTGTGCG[C/T]
TAGCGACTAATTTACCATCCGCTCGCACCCTCTTTCCACCTTTCTCTCGTCCATGTCATCATCCAATCTGACGTGTAGCTCATATCGCCGGCTCAATCTA
TAGATTGAGCCGGCGATATGAGCTACACGTCAGATTGGATGATGACATGGACGAGAGAAAGGTGGAAAGAGGGTGCGAGCGGATGGTAAATTAGTCGCTA[G/A]
CGCACACGAGCTCCTAGGCGCCTGTGCATTGCTTTTTGTCAGTGTTGCAGCGGAGTGAGAGAGGGAAGGGTAAAGAAGAAAGAGATTGAGGTGATTAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.00% | 32.90% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 97.70% | 2.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 15.20% | 84.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 37.90% | 62.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 41.10% | 58.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.10% | 92.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 38.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0433018887 | C -> T | LOC_Os04g55505.1 | upstream_gene_variant ; 3392.0bp to feature; MODIFIER | silent_mutation | Average:53.279; most accessible tissue: Minghui63 root, score: 87.205 | N | N | N | N |
| vg0433018887 | C -> T | LOC_Os04g55510.1 | upstream_gene_variant ; 3829.0bp to feature; MODIFIER | silent_mutation | Average:53.279; most accessible tissue: Minghui63 root, score: 87.205 | N | N | N | N |
| vg0433018887 | C -> T | LOC_Os04g55505-LOC_Os04g55510 | intergenic_region ; MODIFIER | silent_mutation | Average:53.279; most accessible tissue: Minghui63 root, score: 87.205 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0433018887 | NA | 1.90E-08 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433018887 | NA | 4.10E-07 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433018887 | NA | 8.30E-16 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433018887 | NA | 1.57E-07 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433018887 | NA | 1.81E-06 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433018887 | NA | 3.95E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433018887 | NA | 6.61E-07 | mr1295_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433018887 | 6.59E-06 | 1.14E-20 | mr1362_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433018887 | 5.96E-07 | 2.59E-09 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433018887 | NA | 6.05E-06 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433018887 | NA | 6.03E-17 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433018887 | NA | 1.46E-08 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |