Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0433014019:

Variant ID: vg0433014019 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 33014019
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

CGGTAAAAAAACATTATATCATACGAGTTTGGTCTGCTTTTGTCTTCCCTGCCTCTGCGAATAACAACACAGCTAAAGTCATCTTATTTGAACATACATA[G/T]
TTTGCATGTCACAACAAGGCAAAAGTAAAAGCTAAAGGGGATAAACAAATCCTACGAGAATTGAATATATTCACATGGATACGGCATCATGCACAGGTAG

Reverse complement sequence

CTACCTGTGCATGATGCCGTATCCATGTGAATATATTCAATTCTCGTAGGATTTGTTTATCCCCTTTAGCTTTTACTTTTGCCTTGTTGTGACATGCAAA[C/A]
TATGTATGTTCAAATAAGATGACTTTAGCTGTGTTGTTATTCGCAGAGGCAGGGAAGACAAAAGCAGACCAAACTCGTATGATATAATGTTTTTTTACCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.50%	29.50%	0.08%	0.00%	NA
All Indica	2759	97.70%	2.30%	0.00%	0.00%	NA
All Japonica	1512	23.50%	76.20%	0.26%	0.00%	NA
Aus	269	56.10%	43.90%	0.00%	0.00%	NA
Indica I	595	94.10%	5.90%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	2.50%	0.00%	0.00%	NA
Temperate Japonica	767	15.40%	84.20%	0.39%	0.00%	NA
Tropical Japonica	504	38.90%	60.90%	0.20%	0.00%	NA
Japonica Intermediate	241	17.40%	82.60%	0.00%	0.00%	NA
VI/Aromatic	96	70.80%	29.20%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0433014019	G -> T	LOC_Os04g55500.1	downstream_gene_variant ; 1017.0bp to feature; MODIFIER	silent_mutation	Average:76.629; most accessible tissue: Callus, score: 99.824	N	N	N	N
vg0433014019	G -> T	LOC_Os04g55505.1	downstream_gene_variant ; 483.0bp to feature; MODIFIER	silent_mutation	Average:76.629; most accessible tissue: Callus, score: 99.824	N	N	N	N
vg0433014019	G -> T	LOC_Os04g55500-LOC_Os04g55505	intergenic_region ; MODIFIER	silent_mutation	Average:76.629; most accessible tissue: Callus, score: 99.824	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0433014019	G	T	-0.01	0.04	0.03	-0.02	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0433014019	NA	1.64E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019	NA	2.25E-07	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019	3.90E-06	7.82E-10	mr1072_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019	NA	1.86E-07	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019	NA	3.19E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019	NA	8.33E-06	mr1092_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019	NA	3.16E-08	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019	NA	3.02E-06	mr1152_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019	NA	2.41E-06	mr1154_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019	NA	8.48E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019	1.96E-06	2.35E-09	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019	NA	1.73E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019	NA	2.79E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019	NA	7.32E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019	NA	9.19E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019	NA	1.02E-06	mr1870_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251