Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433014019:

Variant ID: vg0433014019 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33014019
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTAAAAAAACATTATATCATACGAGTTTGGTCTGCTTTTGTCTTCCCTGCCTCTGCGAATAACAACACAGCTAAAGTCATCTTATTTGAACATACATA[G/T]
TTTGCATGTCACAACAAGGCAAAAGTAAAAGCTAAAGGGGATAAACAAATCCTACGAGAATTGAATATATTCACATGGATACGGCATCATGCACAGGTAG

Reverse complement sequence

CTACCTGTGCATGATGCCGTATCCATGTGAATATATTCAATTCTCGTAGGATTTGTTTATCCCCTTTAGCTTTTACTTTTGCCTTGTTGTGACATGCAAA[C/A]
TATGTATGTTCAAATAAGATGACTTTAGCTGTGTTGTTATTCGCAGAGGCAGGGAAGACAAAAGCAGACCAAACTCGTATGATATAATGTTTTTTTACCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 29.50% 0.08% 0.00% NA
All Indica  2759 97.70% 2.30% 0.00% 0.00% NA
All Japonica  1512 23.50% 76.20% 0.26% 0.00% NA
Aus  269 56.10% 43.90% 0.00% 0.00% NA
Indica I  595 94.10% 5.90% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.50% 0.00% 0.00% NA
Temperate Japonica  767 15.40% 84.20% 0.39% 0.00% NA
Tropical Japonica  504 38.90% 60.90% 0.20% 0.00% NA
Japonica Intermediate  241 17.40% 82.60% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433014019 G -> T LOC_Os04g55500.1 downstream_gene_variant ; 1017.0bp to feature; MODIFIER silent_mutation Average:76.629; most accessible tissue: Callus, score: 99.824 N N N N
vg0433014019 G -> T LOC_Os04g55505.1 downstream_gene_variant ; 483.0bp to feature; MODIFIER silent_mutation Average:76.629; most accessible tissue: Callus, score: 99.824 N N N N
vg0433014019 G -> T LOC_Os04g55500-LOC_Os04g55505 intergenic_region ; MODIFIER silent_mutation Average:76.629; most accessible tissue: Callus, score: 99.824 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0433014019 G T -0.01 0.04 0.03 -0.02 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433014019 NA 1.64E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019 NA 2.25E-07 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019 3.90E-06 7.82E-10 mr1072_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019 NA 1.86E-07 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019 NA 3.19E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019 NA 8.33E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019 NA 3.16E-08 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019 NA 3.02E-06 mr1152_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019 NA 2.41E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019 NA 8.48E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019 1.96E-06 2.35E-09 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019 NA 1.73E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019 NA 2.79E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019 NA 7.32E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019 NA 9.19E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433014019 NA 1.02E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251