Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0432765450:

Variant ID: vg0432765450 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32765450
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, A: 0.06, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

ACAATGGAGCAGACGATTCCCAGTTCTTCTGTTGTTGCGAAGGATAGCGAAGTGGTCAGTGCGATTGCTCGGTCTGTACCAAGGTTCCATGAAGATTACT[A/T]
CGGGCCAAGTGGCCATGAACCTAATCACCATTAAGCACAGCTAGCTAGCTACATATCGCCTTAATTAGTTTTGCCCTTTTCTATTTTAGCAGCAGCAGCT

Reverse complement sequence

AGCTGCTGCTGCTAAAATAGAAAAGGGCAAAACTAATTAAGGCGATATGTAGCTAGCTAGCTGTGCTTAATGGTGATTAGGTTCATGGCCACTTGGCCCG[T/A]
AGTAATCTTCATGGAACCTTGGTACAGACCGAGCAATCGCACTGACCACTTCGCTATCCTTCGCAACAACAGAAGAACTGGGAATCGTCTGCTCCATTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.30%	30.60%	0.08%	0.00%	NA
All Indica	2759	95.90%	4.10%	0.04%	0.00%	NA
All Japonica	1512	22.00%	78.00%	0.07%	0.00%	NA
Aus	269	66.50%	33.50%	0.00%	0.00%	NA
Indica I	595	94.30%	5.70%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	96.70%	3.20%	0.11%	0.00%	NA
Indica Intermediate	786	94.70%	5.30%	0.00%	0.00%	NA
Temperate Japonica	767	10.20%	89.80%	0.00%	0.00%	NA
Tropical Japonica	504	27.60%	72.40%	0.00%	0.00%	NA
Japonica Intermediate	241	47.70%	51.90%	0.41%	0.00%	NA
VI/Aromatic	96	69.80%	29.20%	1.04%	0.00%	NA
Intermediate	90	58.90%	40.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432765450	A -> T	LOC_Os04g55110.1	upstream_gene_variant ; 4109.0bp to feature; MODIFIER	silent_mutation	Average:60.437; most accessible tissue: Callus, score: 94.654	N	N	N	N
vg0432765450	A -> T	LOC_Os04g55090.1	downstream_gene_variant ; 2997.0bp to feature; MODIFIER	silent_mutation	Average:60.437; most accessible tissue: Callus, score: 94.654	N	N	N	N
vg0432765450	A -> T	LOC_Os04g55090.2	downstream_gene_variant ; 2997.0bp to feature; MODIFIER	silent_mutation	Average:60.437; most accessible tissue: Callus, score: 94.654	N	N	N	N
vg0432765450	A -> T	LOC_Os04g55100.1	intron_variant ; MODIFIER	silent_mutation	Average:60.437; most accessible tissue: Callus, score: 94.654	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432765450	NA	3.77E-08	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432765450	NA	2.39E-15	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432765450	NA	2.43E-07	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432765450	6.28E-07	6.07E-08	mr1072_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432765450	9.78E-06	1.26E-06	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432765450	NA	2.91E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432765450	NA	6.83E-06	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251