\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432701215:

Variant ID: vg0432701215 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32701215
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:


TCCGCCTGTTAGTTGCAAGACGGATTTATTAAGAATAATTAATCCATTATTAGTAAATGTTTACTGTAGCACCATATTGTCAAATCATGAAGCAATTAGA[T/C]
TTAAAAGATTCGTCAAGCAATTTACACACAGTCTGTGTAATTAGTTTTTGCGTGGGAACTAAACAATGGCCTAAATAGATCTAACAAAATTTTTCATGAT

Reverse complement sequence

ATCATGAAAAATTTTGTTAGATCTATTTAGGCCATTGTTTAGTTCCCACGCAAAAACTAATTACACAGACTGTGTGTAAATTGCTTGACGAATCTTTTAA[A/G]
TCTAATTGCTTCATGATTTGACAATATGGTGCTACAGTAAACATTTACTAATAATGGATTAATTATTCTTAATAAATCCGTCTTGCAACTAACAGGCGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 33.80% 0.15% 0.00% NA
All Indica  2759 97.10% 2.80% 0.14% 0.00% NA
All Japonica  1512 9.50% 90.30% 0.20% 0.00% NA
Aus  269 66.50% 33.50% 0.00% 0.00% NA
Indica I  595 94.10% 5.70% 0.17% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.10% 0.70% 0.22% 0.00% NA
Indica Intermediate  786 96.10% 3.80% 0.13% 0.00% NA
Temperate Japonica  767 1.30% 98.60% 0.13% 0.00% NA
Tropical Japonica  504 23.20% 76.60% 0.20% 0.00% NA
Japonica Intermediate  241 6.60% 92.90% 0.41% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432701215 T -> C LOC_Os04g54970.1 upstream_gene_variant ; 3303.0bp to feature; MODIFIER silent_mutation Average:54.772; most accessible tissue: Callus, score: 83.228 N N N N
vg0432701215 T -> C LOC_Os04g54980.1 upstream_gene_variant ; 369.0bp to feature; MODIFIER silent_mutation Average:54.772; most accessible tissue: Callus, score: 83.228 N N N N
vg0432701215 T -> C LOC_Os04g54990.1 upstream_gene_variant ; 309.0bp to feature; MODIFIER silent_mutation Average:54.772; most accessible tissue: Callus, score: 83.228 N N N N
vg0432701215 T -> C LOC_Os04g55000.1 upstream_gene_variant ; 2050.0bp to feature; MODIFIER silent_mutation Average:54.772; most accessible tissue: Callus, score: 83.228 N N N N
vg0432701215 T -> C LOC_Os04g54980-LOC_Os04g54990 intergenic_region ; MODIFIER silent_mutation Average:54.772; most accessible tissue: Callus, score: 83.228 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432701215 NA 7.08E-10 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 7.10E-14 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 2.02E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 1.38E-06 1.87E-18 mr1040_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 5.63E-07 7.75E-06 mr1040_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 4.47E-07 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 2.68E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 9.21E-06 3.34E-08 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 7.20E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 2.54E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 2.62E-06 4.96E-08 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 2.41E-06 mr1253_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 5.26E-06 mr1255_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 9.98E-06 3.47E-08 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 2.97E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 1.15E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 1.20E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 9.28E-19 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 5.09E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 7.53E-07 9.26E-08 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 3.72E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 5.21E-06 NA mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 2.47E-06 4.85E-10 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 2.47E-17 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 8.53E-06 NA mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 7.06E-06 mr1852_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 9.27E-06 NA mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 6.25E-06 NA mr1874_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432701215 NA 1.79E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251