Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432694182:

Variant ID: vg0432694182 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32694182
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TAAGTTTTTGCGGCAGATTTTTGACCACACATATCTCTAAGGAATTAACATAAAATATCCTAATTAATAGATACAATTGCCTTCTCAGGACTCTATCCAT[G/A]
CGTGACAATCATCATGAAGCACATTAACCTAAATCGACAACATATGTTGTATCATATTGTCGGATTCGGCTTCATCGGCTAACCTTGTCCGACTCGAACT

Reverse complement sequence

AGTTCGAGTCGGACAAGGTTAGCCGATGAAGCCGAATCCGACAATATGATACAACATATGTTGTCGATTTAGGTTAATGTGCTTCATGATGATTGTCACG[C/T]
ATGGATAGAGTCCTGAGAAGGCAATTGTATCTATTAATTAGGATATTTTATGTTAATTCCTTAGAGATATGTGTGGTCAAAAATCTGCCGCAAAAACTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	9.00%	0.08%	0.00%	NA
All Indica	2759	98.70%	1.30%	0.04%	0.00%	NA
All Japonica	1512	77.80%	22.20%	0.07%	0.00%	NA
Aus	269	90.30%	9.30%	0.37%	0.00%	NA
Indica I	595	96.60%	3.20%	0.17%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.00%	2.00%	0.00%	0.00%	NA
Temperate Japonica	767	78.40%	21.60%	0.00%	0.00%	NA
Tropical Japonica	504	92.50%	7.50%	0.00%	0.00%	NA
Japonica Intermediate	241	45.20%	54.40%	0.41%	0.00%	NA
VI/Aromatic	96	79.20%	19.80%	1.04%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432694182	G -> A	LOC_Os04g54960.1	upstream_gene_variant ; 1529.0bp to feature; MODIFIER	silent_mutation	Average:33.353; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0432694182	G -> A	LOC_Os04g54970.1	downstream_gene_variant ; 2428.0bp to feature; MODIFIER	silent_mutation	Average:33.353; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0432694182	G -> A	LOC_Os04g54980.1	downstream_gene_variant ; 4526.0bp to feature; MODIFIER	silent_mutation	Average:33.353; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0432694182	G -> A	LOC_Os04g54960-LOC_Os04g54970	intergenic_region ; MODIFIER	silent_mutation	Average:33.353; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432694182	NA	5.76E-07	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182	NA	5.78E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182	NA	1.99E-07	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182	NA	3.73E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182	NA	5.11E-06	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182	NA	1.97E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182	NA	1.96E-06	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182	NA	1.27E-09	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182	4.18E-06	4.17E-06	mr1736	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182	3.10E-06	4.26E-09	mr1785	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182	NA	1.60E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182	NA	7.83E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182	NA	2.78E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182	NA	5.69E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182	NA	6.82E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182	NA	2.05E-07	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251