\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432694182:

Variant ID: vg0432694182 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32694182
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGTTTTTGCGGCAGATTTTTGACCACACATATCTCTAAGGAATTAACATAAAATATCCTAATTAATAGATACAATTGCCTTCTCAGGACTCTATCCAT[G/A]
CGTGACAATCATCATGAAGCACATTAACCTAAATCGACAACATATGTTGTATCATATTGTCGGATTCGGCTTCATCGGCTAACCTTGTCCGACTCGAACT

Reverse complement sequence

AGTTCGAGTCGGACAAGGTTAGCCGATGAAGCCGAATCCGACAATATGATACAACATATGTTGTCGATTTAGGTTAATGTGCTTCATGATGATTGTCACG[C/T]
ATGGATAGAGTCCTGAGAAGGCAATTGTATCTATTAATTAGGATATTTTATGTTAATTCCTTAGAGATATGTGTGGTCAAAAATCTGCCGCAAAAACTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 9.00% 0.08% 0.00% NA
All Indica  2759 98.70% 1.30% 0.04% 0.00% NA
All Japonica  1512 77.80% 22.20% 0.07% 0.00% NA
Aus  269 90.30% 9.30% 0.37% 0.00% NA
Indica I  595 96.60% 3.20% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 78.40% 21.60% 0.00% 0.00% NA
Tropical Japonica  504 92.50% 7.50% 0.00% 0.00% NA
Japonica Intermediate  241 45.20% 54.40% 0.41% 0.00% NA
VI/Aromatic  96 79.20% 19.80% 1.04% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432694182 G -> A LOC_Os04g54960.1 upstream_gene_variant ; 1529.0bp to feature; MODIFIER silent_mutation Average:33.353; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0432694182 G -> A LOC_Os04g54970.1 downstream_gene_variant ; 2428.0bp to feature; MODIFIER silent_mutation Average:33.353; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0432694182 G -> A LOC_Os04g54980.1 downstream_gene_variant ; 4526.0bp to feature; MODIFIER silent_mutation Average:33.353; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0432694182 G -> A LOC_Os04g54960-LOC_Os04g54970 intergenic_region ; MODIFIER silent_mutation Average:33.353; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432694182 NA 5.76E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182 NA 5.78E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182 NA 1.99E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182 NA 3.73E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182 NA 5.11E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182 NA 1.97E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182 NA 1.96E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182 NA 1.27E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182 4.18E-06 4.17E-06 mr1736 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182 3.10E-06 4.26E-09 mr1785 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182 NA 1.60E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182 NA 7.83E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182 NA 2.78E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182 NA 5.69E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182 NA 6.82E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432694182 NA 2.05E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251