\
| Variant ID: vg0432657154 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32657154 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.03, others allele: 0.00, population size: 272. )
GGATTATTTAGAACTCTTAATATCATGTGGGGGTACATATATGTCCAAATCAATGGAAATATGATGTGGGACTCAAATTAAATCTTCGTCTATGAACTCC[A/T]
AATTTAAGTAATTCAGAAAAGGTCCAAATTCAGCTAAAATAAAAACACAGGATACAACAGCACGTCCAAGAGAGAGCTGCAATTATAATGCATGCGTGGC
GCCACGCATGCATTATAATTGCAGCTCTCTCTTGGACGTGCTGTTGTATCCTGTGTTTTTATTTTAGCTGAATTTGGACCTTTTCTGAATTACTTAAATT[T/A]
GGAGTTCATAGACGAAGATTTAATTTGAGTCCCACATCATATTTCCATTGATTTGGACATATATGTACCCCCACATGATATTAAGAGTTCTAAATAATCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 43.60% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 34.80% | 64.60% | 0.62% | 0.00% | NA |
| All Japonica | 1512 | 84.30% | 15.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 20.30% | 79.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 42.80% | 56.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 41.90% | 57.20% | 0.88% | 0.00% | NA |
| Indica Intermediate | 786 | 32.70% | 66.50% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 58.30% | 41.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 38.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432657154 | A -> T | LOC_Os04g54890.1 | upstream_gene_variant ; 4426.0bp to feature; MODIFIER | silent_mutation | Average:45.28; most accessible tissue: Callus, score: 57.497 | N | N | N | N |
| vg0432657154 | A -> T | LOC_Os04g54900.1 | downstream_gene_variant ; 599.0bp to feature; MODIFIER | silent_mutation | Average:45.28; most accessible tissue: Callus, score: 57.497 | N | N | N | N |
| vg0432657154 | A -> T | LOC_Os04g54890-LOC_Os04g54900 | intergenic_region ; MODIFIER | silent_mutation | Average:45.28; most accessible tissue: Callus, score: 57.497 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432657154 | NA | 2.64E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432657154 | NA | 1.17E-10 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432657154 | NA | 3.72E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432657154 | NA | 2.40E-08 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432657154 | 1.59E-10 | NA | mr1800_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432657154 | 1.40E-07 | 1.64E-06 | mr1800_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432657154 | 3.68E-06 | NA | mr1873_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |