\
| Variant ID: vg0432640353 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32640353 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 120. )
GCCTTGTATTTATACCCATAGGTGTCCCCTTGTTCAAGTAGAACTAGGGAAAGCAATATGGATACAATCCGAGTAGTCCTTATCGTTTTCATATAGAACT[C/T]
TGGTTGTCTTTCCTTATCCGGAACTCCTCCTATATCCGCAGGTTGTTTCCGTATAGGACATGGTATGTGGTGGGTCCTGCCGAGATTTAGTCAACTACTA
TAGTAGTTGACTAAATCTCGGCAGGACCCACCACATACCATGTCCTATACGGAAACAACCTGCGGATATAGGAGGAGTTCCGGATAAGGAAAGACAACCA[G/A]
AGTTCTATATGAAAACGATAAGGACTACTCGGATTGTATCCATATTGCTTTCCCTAGTTCTACTTGAACAAGGGGACACCTATGGGTATAAATACAAGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.30% | 21.60% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 72.90% | 27.00% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 45.00% | 55.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.60% | 13.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 59.80% | 40.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 68.70% | 31.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 75.10% | 24.60% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 13.50% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432640353 | C -> T | LOC_Os04g54870.1 | upstream_gene_variant ; 2550.0bp to feature; MODIFIER | silent_mutation | Average:39.636; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
| vg0432640353 | C -> T | LOC_Os04g54880.1 | upstream_gene_variant ; 3149.0bp to feature; MODIFIER | silent_mutation | Average:39.636; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
| vg0432640353 | C -> T | LOC_Os04g54870.2 | upstream_gene_variant ; 2516.0bp to feature; MODIFIER | silent_mutation | Average:39.636; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
| vg0432640353 | C -> T | LOC_Os04g54870-LOC_Os04g54880 | intergenic_region ; MODIFIER | silent_mutation | Average:39.636; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432640353 | NA | 8.43E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432640353 | NA | 4.97E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432640353 | NA | 2.80E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432640353 | NA | 1.98E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432640353 | NA | 8.40E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432640353 | NA | 7.94E-06 | mr1408 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432640353 | NA | 2.70E-07 | mr1800 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432640353 | NA | 3.33E-07 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432640353 | NA | 1.20E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432640353 | 6.96E-10 | 6.01E-14 | mr1800_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432640353 | 1.72E-06 | NA | mr1800_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432640353 | 5.10E-09 | 1.12E-14 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |