\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432640353:

Variant ID: vg0432640353 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32640353
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


GCCTTGTATTTATACCCATAGGTGTCCCCTTGTTCAAGTAGAACTAGGGAAAGCAATATGGATACAATCCGAGTAGTCCTTATCGTTTTCATATAGAACT[C/T]
TGGTTGTCTTTCCTTATCCGGAACTCCTCCTATATCCGCAGGTTGTTTCCGTATAGGACATGGTATGTGGTGGGTCCTGCCGAGATTTAGTCAACTACTA

Reverse complement sequence

TAGTAGTTGACTAAATCTCGGCAGGACCCACCACATACCATGTCCTATACGGAAACAACCTGCGGATATAGGAGGAGTTCCGGATAAGGAAAGACAACCA[G/A]
AGTTCTATATGAAAACGATAAGGACTACTCGGATTGTATCCATATTGCTTTCCCTAGTTCTACTTGAACAAGGGGACACCTATGGGTATAAATACAAGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.30% 21.60% 0.13% 0.00% NA
All Indica  2759 72.90% 27.00% 0.14% 0.00% NA
All Japonica  1512 93.30% 6.70% 0.00% 0.00% NA
Aus  269 45.00% 55.00% 0.00% 0.00% NA
Indica I  595 86.60% 13.40% 0.00% 0.00% NA
Indica II  465 59.80% 40.00% 0.22% 0.00% NA
Indica III  913 68.70% 31.30% 0.00% 0.00% NA
Indica Intermediate  786 75.10% 24.60% 0.38% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 81.20% 18.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 13.50% 2.08% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432640353 C -> T LOC_Os04g54870.1 upstream_gene_variant ; 2550.0bp to feature; MODIFIER silent_mutation Average:39.636; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N
vg0432640353 C -> T LOC_Os04g54880.1 upstream_gene_variant ; 3149.0bp to feature; MODIFIER silent_mutation Average:39.636; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N
vg0432640353 C -> T LOC_Os04g54870.2 upstream_gene_variant ; 2516.0bp to feature; MODIFIER silent_mutation Average:39.636; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N
vg0432640353 C -> T LOC_Os04g54870-LOC_Os04g54880 intergenic_region ; MODIFIER silent_mutation Average:39.636; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432640353 NA 8.43E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432640353 NA 4.97E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432640353 NA 2.80E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432640353 NA 1.98E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432640353 NA 8.40E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432640353 NA 7.94E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432640353 NA 2.70E-07 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432640353 NA 3.33E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432640353 NA 1.20E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432640353 6.96E-10 6.01E-14 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432640353 1.72E-06 NA mr1800_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432640353 5.10E-09 1.12E-14 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251