\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432638617:

Variant ID: vg0432638617 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32638617
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCACCAAACTCTCGATCGCCACCACCAATCGGCTGCAGGCTTCTGCATGCCGGTGATCTGGATTAGTGGATGGCCACATCTATTATATATTAAAAGTC[T/C]
ATTAAACTTTGTATAAACCCTTCTAAACCGTCACATAGGACCCTTAAAAACGCTCCTACGCCGCCATGTGACGATCTATTAAGTTATAGAAATTCTAAAA

Reverse complement sequence

TTTTAGAATTTCTATAACTTAATAGATCGTCACATGGCGGCGTAGGAGCGTTTTTAAGGGTCCTATGTGACGGTTTAGAAGGGTTTATACAAAGTTTAAT[A/G]
GACTTTTAATATATAATAGATGTGGCCATCCACTAATCCAGATCACCGGCATGCAGAAGCCTGCAGCCGATTGGTGGTGGCGATCGAGAGTTTGGTGGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 28.00% 1.93% 0.28% NA
All Indica  2759 71.90% 26.90% 0.76% 0.43% NA
All Japonica  1512 69.40% 26.40% 4.17% 0.07% NA
Aus  269 44.20% 55.40% 0.37% 0.00% NA
Indica I  595 83.50% 14.80% 1.51% 0.17% NA
Indica II  465 58.90% 39.60% 0.86% 0.65% NA
Indica III  913 68.80% 30.60% 0.22% 0.44% NA
Indica Intermediate  786 74.30% 24.40% 0.76% 0.51% NA
Temperate Japonica  767 54.60% 37.80% 7.56% 0.00% NA
Tropical Japonica  504 80.40% 19.00% 0.40% 0.20% NA
Japonica Intermediate  241 93.40% 5.40% 1.24% 0.00% NA
VI/Aromatic  96 84.40% 13.50% 2.08% 0.00% NA
Intermediate  90 73.30% 22.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432638617 T -> C LOC_Os04g54870.1 upstream_gene_variant ; 814.0bp to feature; MODIFIER silent_mutation Average:85.996; most accessible tissue: Minghui63 root, score: 95.947 N N N N
vg0432638617 T -> C LOC_Os04g54880.1 upstream_gene_variant ; 4885.0bp to feature; MODIFIER silent_mutation Average:85.996; most accessible tissue: Minghui63 root, score: 95.947 N N N N
vg0432638617 T -> C LOC_Os04g54870.2 upstream_gene_variant ; 780.0bp to feature; MODIFIER silent_mutation Average:85.996; most accessible tissue: Minghui63 root, score: 95.947 N N N N
vg0432638617 T -> C LOC_Os04g54860.1 downstream_gene_variant ; 3796.0bp to feature; MODIFIER silent_mutation Average:85.996; most accessible tissue: Minghui63 root, score: 95.947 N N N N
vg0432638617 T -> C LOC_Os04g54870-LOC_Os04g54880 intergenic_region ; MODIFIER silent_mutation Average:85.996; most accessible tissue: Minghui63 root, score: 95.947 N N N N
vg0432638617 T -> DEL N N silent_mutation Average:85.996; most accessible tissue: Minghui63 root, score: 95.947 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432638617 T C 0.0 0.0 -0.01 -0.02 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432638617 NA 1.37E-12 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432638617 NA 1.15E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432638617 NA 2.61E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432638617 2.32E-06 NA mr1013_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432638617 NA 3.98E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432638617 NA 4.26E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432638617 NA 1.06E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432638617 NA 2.05E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432638617 NA 5.28E-09 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251