\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432594893:

Variant ID: vg0432594893 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32594893
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.21, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCTTGTTTTTTCTTTCGTCGCAGTGGTTTTGCCGGTTTGAGCATAGTAAAACGTGCGTTACTTTCACCGTGCTTTTCCATATGAAAATGTGTACCCAT[T/C]
GTAAAAAGTACTTCTAAGCTAGCTACAGTAGATTCTAGGGGAGAAATTTACTATGGTTATTGTTACGGCGCTTCTTTTAACCTGGAAGTAGCTTGGCAAC

Reverse complement sequence

GTTGCCAAGCTACTTCCAGGTTAAAAGAAGCGCCGTAACAATAACCATAGTAAATTTCTCCCCTAGAATCTACTGTAGCTAGCTTAGAAGTACTTTTTAC[A/G]
ATGGGTACACATTTTCATATGGAAAAGCACGGTGAAAGTAACGCACGTTTTACTATGCTCAAACCGGCAAAACCACTGCGACGAAAGAAAAAACAAGAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 32.00% 0.34% 0.28% NA
All Indica  2759 75.30% 24.00% 0.33% 0.40% NA
All Japonica  1512 63.40% 36.40% 0.20% 0.07% NA
Aus  269 12.30% 87.40% 0.00% 0.37% NA
Indica I  595 89.60% 9.70% 0.50% 0.17% NA
Indica II  465 81.50% 18.10% 0.00% 0.43% NA
Indica III  913 59.10% 40.00% 0.44% 0.44% NA
Indica Intermediate  786 79.60% 19.60% 0.25% 0.51% NA
Temperate Japonica  767 70.90% 28.80% 0.26% 0.00% NA
Tropical Japonica  504 67.50% 32.30% 0.00% 0.20% NA
Japonica Intermediate  241 30.70% 68.90% 0.41% 0.00% NA
VI/Aromatic  96 61.50% 38.50% 0.00% 0.00% NA
Intermediate  90 63.30% 32.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432594893 T -> C LOC_Os04g54810.1 intron_variant ; MODIFIER silent_mutation Average:75.117; most accessible tissue: Zhenshan97 panicle, score: 93.244 N N N N
vg0432594893 T -> DEL N N silent_mutation Average:75.117; most accessible tissue: Zhenshan97 panicle, score: 93.244 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432594893 T C 0.01 0.04 0.04 0.02 0.04 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432594893 NA 1.00E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432594893 NA 5.89E-08 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432594893 2.54E-06 1.17E-08 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432594893 1.80E-06 3.87E-08 mr1800 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432594893 NA 2.66E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432594893 NA 8.16E-07 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432594893 1.86E-07 4.01E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432594893 3.01E-07 NA mr1784_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432594893 NA 8.68E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432594893 9.25E-11 NA mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432594893 6.96E-11 2.35E-12 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432594893 9.67E-06 NA mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251