\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432569391:

Variant ID: vg0432569391 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32569391
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


CATCTTGAAGCACATCAACTCGAACCCAATGTCGCACACGGGTTGTATTGTCGGAATCGGCTGTATCACTTAACCAGTCCGACTCAGACTTAGCCGATCC[C/T]
AGTCGTAGCCGATCCGAACTCCAGCCGATTCTTACTCTGTTTCCGAAAAAACCCTTATCTCCGATGCTGATATTACCAAATTTGGTCGTTAACACATGCC

Reverse complement sequence

GGCATGTGTTAACGACCAAATTTGGTAATATCAGCATCGGAGATAAGGGTTTTTTCGGAAACAGAGTAAGAATCGGCTGGAGTTCGGATCGGCTACGACT[G/A]
GGATCGGCTAAGTCTGAGTCGGACTGGTTAAGTGATACAGCCGATTCCGACAATACAACCCGTGTGCGACATTGGGTTCGAGTTGATGTGCTTCAAGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.30% 21.20% 0.49% 0.00% NA
All Indica  2759 81.30% 17.90% 0.76% 0.00% NA
All Japonica  1512 79.70% 20.30% 0.00% 0.00% NA
Aus  269 37.90% 61.30% 0.74% 0.00% NA
Indica I  595 92.10% 7.70% 0.17% 0.00% NA
Indica II  465 84.70% 14.60% 0.65% 0.00% NA
Indica III  913 69.40% 29.10% 1.42% 0.00% NA
Indica Intermediate  786 85.00% 14.50% 0.51% 0.00% NA
Temperate Japonica  767 93.10% 6.90% 0.00% 0.00% NA
Tropical Japonica  504 74.40% 25.60% 0.00% 0.00% NA
Japonica Intermediate  241 48.10% 51.90% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432569391 C -> T LOC_Os04g54759.1 upstream_gene_variant ; 3986.0bp to feature; MODIFIER silent_mutation Average:35.568; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg0432569391 C -> T LOC_Os04g54780.1 upstream_gene_variant ; 355.0bp to feature; MODIFIER silent_mutation Average:35.568; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg0432569391 C -> T LOC_Os04g54759-LOC_Os04g54780 intergenic_region ; MODIFIER silent_mutation Average:35.568; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432569391 NA 2.73E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432569391 NA 1.51E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432569391 NA 2.13E-06 mr1800 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432569391 NA 3.79E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432569391 NA 8.68E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432569391 1.62E-06 1.62E-06 mr1597_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432569391 NA 5.13E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432569391 NA 1.99E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432569391 5.15E-06 1.18E-08 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432569391 4.37E-06 NA mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432569391 6.75E-07 NA mr1784_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432569391 NA 7.05E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432569391 2.32E-09 NA mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432569391 1.39E-09 2.14E-10 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432569391 2.51E-06 NA mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432569391 NA 7.09E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251