Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432505180:

Variant ID: vg0432505180 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32505180
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTCGCCGCCGTCGGTGGTCGGTGGTTGCTACTTCCAGCCGCGGGGGCCAGTGTTGAACCGCTACATCCCCTGCGCCCTCCGCAAGAAGTGGGACGATTG[A/G]
AAGAGCGATTGGTTCTACACCCCCCTTGCCAACGAAGCGCGCCTTCGACTCCCAAGCCAGCCCCCGGCGCCGGTCTCCAGCTGGCGGGCGCCAGTAGATC

Reverse complement sequence

GATCTACTGGCGCCCGCCAGCTGGAGACCGGCGCCGGGGGCTGGCTTGGGAGTCGAAGGCGCGCTTCGTTGGCAAGGGGGGTGTAGAACCAATCGCTCTT[T/C]
CAATCGTCCCACTTCTTGCGGAGGGCGCAGGGGATGTAGCGGTTCAACACTGGCCCCCGCGGCTGGAAGTAGCAACCACCGACCACCGACGGCGGCGACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.20%	1.50%	4.38%	23.93%	NA
All Indica	2759	76.20%	0.30%	3.99%	19.46%	NA
All Japonica	1512	71.20%	1.90%	3.97%	23.02%	NA
Aus	269	14.10%	11.50%	10.41%	63.94%	NA
Indica I	595	91.80%	0.30%	1.68%	6.22%	NA
Indica II	465	76.30%	0.00%	2.37%	21.29%	NA
Indica III	913	62.90%	0.00%	7.89%	29.24%	NA
Indica Intermediate	786	79.90%	0.90%	2.16%	17.05%	NA
Temperate Japonica	767	75.10%	2.30%	2.61%	19.95%	NA
Tropical Japonica	504	74.00%	0.60%	5.16%	20.24%	NA
Japonica Intermediate	241	52.70%	2.90%	5.81%	38.59%	NA
VI/Aromatic	96	37.50%	0.00%	5.21%	57.29%	NA
Intermediate	90	72.20%	2.20%	4.44%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432505180	A -> DEL	N	N	silent_mutation	Average:25.554; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0432505180	A -> G	LOC_Os04g54650.1	upstream_gene_variant ; 1636.0bp to feature; MODIFIER	silent_mutation	Average:25.554; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0432505180	A -> G	LOC_Os04g54700.1	downstream_gene_variant ; 3403.0bp to feature; MODIFIER	silent_mutation	Average:25.554; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0432505180	A -> G	LOC_Os04g54690.1	intron_variant ; MODIFIER	silent_mutation	Average:25.554; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432505180	NA	4.60E-06	mr1101	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432505180	NA	6.07E-06	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432505180	4.48E-06	3.50E-06	mr1116	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432505180	7.05E-06	3.21E-07	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432505180	NA	7.53E-06	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432505180	5.86E-06	2.71E-07	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432505180	NA	3.28E-06	mr1150	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432505180	NA	5.69E-07	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432505180	4.71E-06	3.10E-07	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432505180	1.22E-06	3.88E-08	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432505180	2.02E-07	2.64E-09	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432505180	6.58E-07	6.58E-07	mr1589	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432505180	2.57E-07	1.54E-08	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432505180	3.70E-06	1.71E-07	mr1936	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251