\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432467580:

Variant ID: vg0432467580 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32467580
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.43, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGTCATCGCCATCGTCACCGCCTCGGCCCCGCCACTCCCGCGCTAGCCTCCAAGGGACGGAGGCAGAGCCTCCCTCCTCCCTCTGCCGCGACGCCTCC[A/G]
CTCCCTCCTCCTTTTCCCGAAGAGGCAAGGGGACAAGCCCCTTTCCCCCCCTCCTTTTTCCCCTTTTTCCTTCCGCCGGCGTCATCCTCCCTCCCTCCTG

Reverse complement sequence

CAGGAGGGAGGGAGGATGACGCCGGCGGAAGGAAAAAGGGGAAAAAGGAGGGGGGGAAAGGGGCTTGTCCCCTTGCCTCTTCGGGAAAAGGAGGAGGGAG[T/C]
GGAGGCGTCGCGGCAGAGGGAGGAGGGAGGCTCTGCCTCCGTCCCTTGGAGGCTAGCGCGGGAGTGGCGGGGCCGAGGCGGTGACGATGGCGATGACGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 27.30% 6.88% 8.25% NA
All Indica  2759 81.80% 4.10% 7.97% 6.13% NA
All Japonica  1512 25.70% 67.10% 1.46% 5.75% NA
Aus  269 7.10% 42.00% 21.56% 29.37% NA
Indica I  595 84.90% 9.20% 1.18% 4.71% NA
Indica II  465 82.40% 3.00% 9.25% 5.38% NA
Indica III  913 79.60% 1.10% 13.25% 6.02% NA
Indica Intermediate  786 81.70% 4.30% 6.23% 7.76% NA
Temperate Japonica  767 3.30% 96.10% 0.39% 0.26% NA
Tropical Japonica  504 67.10% 16.70% 0.99% 15.28% NA
Japonica Intermediate  241 10.40% 80.50% 5.81% 3.32% NA
VI/Aromatic  96 9.40% 20.80% 22.92% 46.88% NA
Intermediate  90 53.30% 32.20% 3.33% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432467580 A -> DEL N N silent_mutation Average:35.552; most accessible tissue: Zhenshan97 flower, score: 77.563 N N N N
vg0432467580 A -> G LOC_Os04g54600.1 downstream_gene_variant ; 1506.0bp to feature; MODIFIER silent_mutation Average:35.552; most accessible tissue: Zhenshan97 flower, score: 77.563 N N N N
vg0432467580 A -> G LOC_Os04g54600-LOC_Os04g54610 intergenic_region ; MODIFIER silent_mutation Average:35.552; most accessible tissue: Zhenshan97 flower, score: 77.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432467580 NA 3.75E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580 NA 2.43E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580 NA 1.36E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580 NA 3.41E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580 NA 5.73E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580 NA 6.10E-21 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580 NA 9.16E-08 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580 4.99E-06 3.36E-10 mr1741_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580 NA 2.29E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251