\
| Variant ID: vg0432467580 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32467580 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.43, others allele: 0.00, population size: 54. )
GCCGTCATCGCCATCGTCACCGCCTCGGCCCCGCCACTCCCGCGCTAGCCTCCAAGGGACGGAGGCAGAGCCTCCCTCCTCCCTCTGCCGCGACGCCTCC[A/G]
CTCCCTCCTCCTTTTCCCGAAGAGGCAAGGGGACAAGCCCCTTTCCCCCCCTCCTTTTTCCCCTTTTTCCTTCCGCCGGCGTCATCCTCCCTCCCTCCTG
CAGGAGGGAGGGAGGATGACGCCGGCGGAAGGAAAAAGGGGAAAAAGGAGGGGGGGAAAGGGGCTTGTCCCCTTGCCTCTTCGGGAAAAGGAGGAGGGAG[T/C]
GGAGGCGTCGCGGCAGAGGGAGGAGGGAGGCTCTGCCTCCGTCCCTTGGAGGCTAGCGCGGGAGTGGCGGGGCCGAGGCGGTGACGATGGCGATGACGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.60% | 27.30% | 6.88% | 8.25% | NA |
| All Indica | 2759 | 81.80% | 4.10% | 7.97% | 6.13% | NA |
| All Japonica | 1512 | 25.70% | 67.10% | 1.46% | 5.75% | NA |
| Aus | 269 | 7.10% | 42.00% | 21.56% | 29.37% | NA |
| Indica I | 595 | 84.90% | 9.20% | 1.18% | 4.71% | NA |
| Indica II | 465 | 82.40% | 3.00% | 9.25% | 5.38% | NA |
| Indica III | 913 | 79.60% | 1.10% | 13.25% | 6.02% | NA |
| Indica Intermediate | 786 | 81.70% | 4.30% | 6.23% | 7.76% | NA |
| Temperate Japonica | 767 | 3.30% | 96.10% | 0.39% | 0.26% | NA |
| Tropical Japonica | 504 | 67.10% | 16.70% | 0.99% | 15.28% | NA |
| Japonica Intermediate | 241 | 10.40% | 80.50% | 5.81% | 3.32% | NA |
| VI/Aromatic | 96 | 9.40% | 20.80% | 22.92% | 46.88% | NA |
| Intermediate | 90 | 53.30% | 32.20% | 3.33% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432467580 | A -> DEL | N | N | silent_mutation | Average:35.552; most accessible tissue: Zhenshan97 flower, score: 77.563 | N | N | N | N |
| vg0432467580 | A -> G | LOC_Os04g54600.1 | downstream_gene_variant ; 1506.0bp to feature; MODIFIER | silent_mutation | Average:35.552; most accessible tissue: Zhenshan97 flower, score: 77.563 | N | N | N | N |
| vg0432467580 | A -> G | LOC_Os04g54600-LOC_Os04g54610 | intergenic_region ; MODIFIER | silent_mutation | Average:35.552; most accessible tissue: Zhenshan97 flower, score: 77.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432467580 | NA | 3.75E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432467580 | NA | 2.43E-13 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432467580 | NA | 1.36E-06 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432467580 | NA | 3.41E-07 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432467580 | NA | 5.73E-06 | mr1295_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432467580 | NA | 6.10E-21 | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432467580 | NA | 9.16E-08 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432467580 | 4.99E-06 | 3.36E-10 | mr1741_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432467580 | NA | 2.29E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |