\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432452537:

Variant ID: vg0432452537 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32452537
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CTAATTTATTTTCTGGGTTCTACGACTAAAACTCTTTAAAATCTAAGTGAAAATCTAGACTGTTTGATAGATCTTCTATCAGCCAGAGATTCTAAGAGAA[G/T,A]
CTGCAGCTGACAGAAGCTCCTCCAAATAGACAAAAAAATTAAGTTGCCGTGGCTCTAATGCAATCTGGGCTAAACATATGTGTTGAACCTTATCCGGTTA

Reverse complement sequence

TAACCGGATAAGGTTCAACACATATGTTTAGCCCAGATTGCATTAGAGCCACGGCAACTTAATTTTTTTGTCTATTTGGAGGAGCTTCTGTCAGCTGCAG[C/A,T]
TTCTCTTAGAATCTCTGGCTGATAGAAGATCTATCAAACAGTCTAGATTTTCACTTAGATTTTAAAGAGTTTTAGTCGTAGAACCCAGAAAATAAATTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.60% 48.30% 0.02% 0.00% A: 0.04%
All Indica  2759 32.10% 67.70% 0.04% 0.00% A: 0.07%
All Japonica  1512 75.70% 24.30% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 17.50% 82.40% 0.17% 0.00% NA
Indica II  465 27.30% 72.70% 0.00% 0.00% NA
Indica III  913 49.60% 50.20% 0.00% 0.00% A: 0.22%
Indica Intermediate  786 25.80% 74.20% 0.00% 0.00% NA
Temperate Japonica  767 97.40% 2.60% 0.00% 0.00% NA
Tropical Japonica  504 35.10% 64.90% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432452537 G -> A LOC_Os04g54560.1 upstream_gene_variant ; 2212.0bp to feature; MODIFIER silent_mutation Average:85.212; most accessible tissue: Callus, score: 96.819 N N N N
vg0432452537 G -> A LOC_Os04g54580.1 upstream_gene_variant ; 4519.0bp to feature; MODIFIER silent_mutation Average:85.212; most accessible tissue: Callus, score: 96.819 N N N N
vg0432452537 G -> A LOC_Os04g54564.1 downstream_gene_variant ; 663.0bp to feature; MODIFIER silent_mutation Average:85.212; most accessible tissue: Callus, score: 96.819 N N N N
vg0432452537 G -> A LOC_Os04g54570.1 downstream_gene_variant ; 728.0bp to feature; MODIFIER silent_mutation Average:85.212; most accessible tissue: Callus, score: 96.819 N N N N
vg0432452537 G -> A LOC_Os04g54564-LOC_Os04g54570 intergenic_region ; MODIFIER silent_mutation Average:85.212; most accessible tissue: Callus, score: 96.819 N N N N
vg0432452537 G -> T LOC_Os04g54560.1 upstream_gene_variant ; 2212.0bp to feature; MODIFIER silent_mutation Average:85.212; most accessible tissue: Callus, score: 96.819 N N N N
vg0432452537 G -> T LOC_Os04g54580.1 upstream_gene_variant ; 4519.0bp to feature; MODIFIER silent_mutation Average:85.212; most accessible tissue: Callus, score: 96.819 N N N N
vg0432452537 G -> T LOC_Os04g54564.1 downstream_gene_variant ; 663.0bp to feature; MODIFIER silent_mutation Average:85.212; most accessible tissue: Callus, score: 96.819 N N N N
vg0432452537 G -> T LOC_Os04g54570.1 downstream_gene_variant ; 728.0bp to feature; MODIFIER silent_mutation Average:85.212; most accessible tissue: Callus, score: 96.819 N N N N
vg0432452537 G -> T LOC_Os04g54564-LOC_Os04g54570 intergenic_region ; MODIFIER silent_mutation Average:85.212; most accessible tissue: Callus, score: 96.819 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432452537 NA 9.83E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432452537 1.12E-06 1.13E-12 mr1403 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432452537 NA 9.96E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432452537 3.63E-06 2.97E-08 mr1800 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432452537 NA 2.17E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432452537 1.63E-12 NA mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432452537 8.89E-10 2.87E-12 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251