\
| Variant ID: vg0432452537 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32452537 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.03, others allele: 0.00, population size: 109. )
CTAATTTATTTTCTGGGTTCTACGACTAAAACTCTTTAAAATCTAAGTGAAAATCTAGACTGTTTGATAGATCTTCTATCAGCCAGAGATTCTAAGAGAA[G/T,A]
CTGCAGCTGACAGAAGCTCCTCCAAATAGACAAAAAAATTAAGTTGCCGTGGCTCTAATGCAATCTGGGCTAAACATATGTGTTGAACCTTATCCGGTTA
TAACCGGATAAGGTTCAACACATATGTTTAGCCCAGATTGCATTAGAGCCACGGCAACTTAATTTTTTTGTCTATTTGGAGGAGCTTCTGTCAGCTGCAG[C/A,T]
TTCTCTTAGAATCTCTGGCTGATAGAAGATCTATCAAACAGTCTAGATTTTCACTTAGATTTTAAAGAGTTTTAGTCGTAGAACCCAGAAAATAAATTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.60% | 48.30% | 0.02% | 0.00% | A: 0.04% |
| All Indica | 2759 | 32.10% | 67.70% | 0.04% | 0.00% | A: 0.07% |
| All Japonica | 1512 | 75.70% | 24.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 17.50% | 82.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 27.30% | 72.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 49.60% | 50.20% | 0.00% | 0.00% | A: 0.22% |
| Indica Intermediate | 786 | 25.80% | 74.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 35.10% | 64.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 46.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432452537 | G -> A | LOC_Os04g54560.1 | upstream_gene_variant ; 2212.0bp to feature; MODIFIER | silent_mutation | Average:85.212; most accessible tissue: Callus, score: 96.819 | N | N | N | N |
| vg0432452537 | G -> A | LOC_Os04g54580.1 | upstream_gene_variant ; 4519.0bp to feature; MODIFIER | silent_mutation | Average:85.212; most accessible tissue: Callus, score: 96.819 | N | N | N | N |
| vg0432452537 | G -> A | LOC_Os04g54564.1 | downstream_gene_variant ; 663.0bp to feature; MODIFIER | silent_mutation | Average:85.212; most accessible tissue: Callus, score: 96.819 | N | N | N | N |
| vg0432452537 | G -> A | LOC_Os04g54570.1 | downstream_gene_variant ; 728.0bp to feature; MODIFIER | silent_mutation | Average:85.212; most accessible tissue: Callus, score: 96.819 | N | N | N | N |
| vg0432452537 | G -> A | LOC_Os04g54564-LOC_Os04g54570 | intergenic_region ; MODIFIER | silent_mutation | Average:85.212; most accessible tissue: Callus, score: 96.819 | N | N | N | N |
| vg0432452537 | G -> T | LOC_Os04g54560.1 | upstream_gene_variant ; 2212.0bp to feature; MODIFIER | silent_mutation | Average:85.212; most accessible tissue: Callus, score: 96.819 | N | N | N | N |
| vg0432452537 | G -> T | LOC_Os04g54580.1 | upstream_gene_variant ; 4519.0bp to feature; MODIFIER | silent_mutation | Average:85.212; most accessible tissue: Callus, score: 96.819 | N | N | N | N |
| vg0432452537 | G -> T | LOC_Os04g54564.1 | downstream_gene_variant ; 663.0bp to feature; MODIFIER | silent_mutation | Average:85.212; most accessible tissue: Callus, score: 96.819 | N | N | N | N |
| vg0432452537 | G -> T | LOC_Os04g54570.1 | downstream_gene_variant ; 728.0bp to feature; MODIFIER | silent_mutation | Average:85.212; most accessible tissue: Callus, score: 96.819 | N | N | N | N |
| vg0432452537 | G -> T | LOC_Os04g54564-LOC_Os04g54570 | intergenic_region ; MODIFIER | silent_mutation | Average:85.212; most accessible tissue: Callus, score: 96.819 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432452537 | NA | 9.83E-08 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432452537 | 1.12E-06 | 1.13E-12 | mr1403 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432452537 | NA | 9.96E-07 | mr1403 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432452537 | 3.63E-06 | 2.97E-08 | mr1800 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432452537 | NA | 2.17E-08 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432452537 | 1.63E-12 | NA | mr1800_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432452537 | 8.89E-10 | 2.87E-12 | mr1800_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |