\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432446360:

Variant ID: vg0432446360 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32446360
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.10, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGTAGGGGCGACGTGTTTGTGATTAGGCCCCTGCAACTGAACTACTCGTTCTGAAAAGAATTCAATCCTACCAACAAACCTCGACAAATTATTTTGGG[A/G]
CGACGTGTTTGTGATTAGGTCCCTGCAACTCAACTAGGGAAGGCAACGGGTCGGGTCGGGCATGGGTAGAGCAAAACCATGCTCGAACCCATGCCCGTCG

Reverse complement sequence

CGACGGGCATGGGTTCGAGCATGGTTTTGCTCTACCCATGCCCGACCCGACCCGTTGCCTTCCCTAGTTGAGTTGCAGGGACCTAATCACAAACACGTCG[T/C]
CCCAAAATAATTTGTCGAGGTTTGTTGGTAGGATTGAATTCTTTTCAGAACGAGTAGTTCAGTTGCAGGGGCCTAATCACAAACACGTCGCCCCTACTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.60% 20.80% 1.29% 1.33% NA
All Indica  2759 72.20% 23.40% 2.14% 2.25% NA
All Japonica  1512 93.50% 6.40% 0.00% 0.07% NA
Aus  269 24.20% 75.80% 0.00% 0.00% NA
Indica I  595 92.60% 7.20% 0.17% 0.00% NA
Indica II  465 75.70% 17.00% 0.65% 6.67% NA
Indica III  913 52.00% 41.10% 5.15% 1.75% NA
Indica Intermediate  786 78.20% 18.80% 1.02% 1.91% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 81.70% 18.30% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 82.20% 15.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432446360 A -> DEL N N silent_mutation Average:87.778; most accessible tissue: Minghui63 flag leaf, score: 95.773 N N N N
vg0432446360 A -> G LOC_Os04g54550.1 upstream_gene_variant ; 432.0bp to feature; MODIFIER silent_mutation Average:87.778; most accessible tissue: Minghui63 flag leaf, score: 95.773 N N N N
vg0432446360 A -> G LOC_Os04g54564.1 upstream_gene_variant ; 4152.0bp to feature; MODIFIER silent_mutation Average:87.778; most accessible tissue: Minghui63 flag leaf, score: 95.773 N N N N
vg0432446360 A -> G LOC_Os04g54560.1 downstream_gene_variant ; 2130.0bp to feature; MODIFIER silent_mutation Average:87.778; most accessible tissue: Minghui63 flag leaf, score: 95.773 N N N N
vg0432446360 A -> G LOC_Os04g54550-LOC_Os04g54560 intergenic_region ; MODIFIER silent_mutation Average:87.778; most accessible tissue: Minghui63 flag leaf, score: 95.773 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432446360 A G 0.05 0.03 0.02 0.03 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432446360 NA 4.92E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 NA 7.75E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 NA 5.34E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 NA 2.60E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 6.93E-06 2.18E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 8.36E-06 1.48E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 1.27E-09 4.74E-14 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 1.76E-09 3.16E-11 mr1800 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 1.49E-06 NA mr1862 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 NA 9.80E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 NA 9.62E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 NA 3.74E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 NA 1.09E-06 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 NA 1.72E-08 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 8.25E-09 4.96E-16 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 NA 9.63E-08 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 1.37E-15 3.48E-26 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 7.50E-12 1.42E-13 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 5.59E-07 6.71E-12 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432446360 3.19E-06 NA mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251