\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432443771:

Variant ID: vg0432443771 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32443771
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.29, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AACATCCAAAAACGATATTTTTTTTTCACTTTTAAACCTTTTTTATTTTAAAAATAAATTCATCAAAAATTTATTTTAAAGTTAAACATTTTGTCCATAT[C/T]
AACCTACCTGGCATGGCAAGACAACACTGACATATCATCTACAACGAGCGTGATAGTTTTATCCTAACATGTCAATGTAAGACAATGTCTTCACGCTATT

Reverse complement sequence

AATAGCGTGAAGACATTGTCTTACATTGACATGTTAGGATAAAACTATCACGCTCGTTGTAGATGATATGTCAGTGTTGTCTTGCCATGCCAGGTAGGTT[G/A]
ATATGGACAAAATGTTTAACTTTAAAATAAATTTTTGATGAATTTATTTTTAAAATAAAAAAGGTTTAAAAGTGAAAAAAAAATATCGTTTTTGGATGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.70% 48.20% 0.02% 0.00% NA
All Indica  2759 32.30% 67.70% 0.04% 0.00% NA
All Japonica  1512 75.90% 24.10% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 17.50% 82.50% 0.00% 0.00% NA
Indica II  465 27.30% 72.70% 0.00% 0.00% NA
Indica III  913 49.80% 50.10% 0.11% 0.00% NA
Indica Intermediate  786 26.00% 74.00% 0.00% 0.00% NA
Temperate Japonica  767 97.70% 2.30% 0.00% 0.00% NA
Tropical Japonica  504 35.50% 64.50% 0.00% 0.00% NA
Japonica Intermediate  241 90.90% 9.10% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432443771 C -> T LOC_Os04g54540.1 upstream_gene_variant ; 4293.0bp to feature; MODIFIER silent_mutation Average:48.912; most accessible tissue: Callus, score: 79.272 N N N N
vg0432443771 C -> T LOC_Os04g54550.1 downstream_gene_variant ; 1627.0bp to feature; MODIFIER silent_mutation Average:48.912; most accessible tissue: Callus, score: 79.272 N N N N
vg0432443771 C -> T LOC_Os04g54560.1 downstream_gene_variant ; 4719.0bp to feature; MODIFIER silent_mutation Average:48.912; most accessible tissue: Callus, score: 79.272 N N N N
vg0432443771 C -> T LOC_Os04g54540-LOC_Os04g54550 intergenic_region ; MODIFIER silent_mutation Average:48.912; most accessible tissue: Callus, score: 79.272 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432443771 NA 1.34E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443771 2.14E-06 1.11E-12 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443771 7.27E-07 NA mr1800 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443771 4.30E-07 3.00E-09 mr1800 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443771 NA 8.56E-06 mr1388_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443771 8.64E-11 NA mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432443771 3.17E-09 8.39E-12 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251