Variant ID: vg0432443771 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 32443771 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.29, others allele: 0.00, population size: 86. )
AACATCCAAAAACGATATTTTTTTTTCACTTTTAAACCTTTTTTATTTTAAAAATAAATTCATCAAAAATTTATTTTAAAGTTAAACATTTTGTCCATAT[C/T]
AACCTACCTGGCATGGCAAGACAACACTGACATATCATCTACAACGAGCGTGATAGTTTTATCCTAACATGTCAATGTAAGACAATGTCTTCACGCTATT
AATAGCGTGAAGACATTGTCTTACATTGACATGTTAGGATAAAACTATCACGCTCGTTGTAGATGATATGTCAGTGTTGTCTTGCCATGCCAGGTAGGTT[G/A]
ATATGGACAAAATGTTTAACTTTAAAATAAATTTTTGATGAATTTATTTTTAAAATAAAAAAGGTTTAAAAGTGAAAAAAAAATATCGTTTTTGGATGTT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 51.70% | 48.20% | 0.02% | 0.00% | NA |
All Indica | 2759 | 32.30% | 67.70% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 75.90% | 24.10% | 0.00% | 0.00% | NA |
Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 17.50% | 82.50% | 0.00% | 0.00% | NA |
Indica II | 465 | 27.30% | 72.70% | 0.00% | 0.00% | NA |
Indica III | 913 | 49.80% | 50.10% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 26.00% | 74.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 35.50% | 64.50% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 54.40% | 45.60% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0432443771 | C -> T | LOC_Os04g54540.1 | upstream_gene_variant ; 4293.0bp to feature; MODIFIER | silent_mutation | Average:48.912; most accessible tissue: Callus, score: 79.272 | N | N | N | N |
vg0432443771 | C -> T | LOC_Os04g54550.1 | downstream_gene_variant ; 1627.0bp to feature; MODIFIER | silent_mutation | Average:48.912; most accessible tissue: Callus, score: 79.272 | N | N | N | N |
vg0432443771 | C -> T | LOC_Os04g54560.1 | downstream_gene_variant ; 4719.0bp to feature; MODIFIER | silent_mutation | Average:48.912; most accessible tissue: Callus, score: 79.272 | N | N | N | N |
vg0432443771 | C -> T | LOC_Os04g54540-LOC_Os04g54550 | intergenic_region ; MODIFIER | silent_mutation | Average:48.912; most accessible tissue: Callus, score: 79.272 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0432443771 | NA | 1.34E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0432443771 | 2.14E-06 | 1.11E-12 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0432443771 | 7.27E-07 | NA | mr1800 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0432443771 | 4.30E-07 | 3.00E-09 | mr1800 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0432443771 | NA | 8.56E-06 | mr1388_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0432443771 | 8.64E-11 | NA | mr1800_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0432443771 | 3.17E-09 | 8.39E-12 | mr1800_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |