\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432416194:

Variant ID: vg0432416194 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32416194
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AGATGCCACCCTCTTCCTATAAAATTGGAGATCGCCAAGTAAAAATGCATCGTGTTTTTTTTTTCTTTTCCGGGCAGCTGAAGAAGGATCGATCAAATTT[C/T]
ATTTTAGATAAGAAGCTTTGTGAATTTCGATAAGAAACTGTCAAGCTGAAAAGAATATCCTAGGTGGTTCATACCTTGAATCGTGGATAGACTCCATATG

Reverse complement sequence

CATATGGAGTCTATCCACGATTCAAGGTATGAACCACCTAGGATATTCTTTTCAGCTTGACAGTTTCTTATCGAAATTCACAAAGCTTCTTATCTAAAAT[G/A]
AAATTTGATCGATCCTTCTTCAGCTGCCCGGAAAAGAAAAAAAAAACACGATGCATTTTTACTTGGCGATCTCCAATTTTATAGGAAGAGGGTGGCATCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.70% 17.30% 0.04% 0.02% NA
All Indica  2759 80.10% 19.90% 0.04% 0.00% NA
All Japonica  1512 93.50% 6.40% 0.07% 0.00% NA
Aus  269 38.70% 61.00% 0.00% 0.37% NA
Indica I  595 90.80% 9.20% 0.00% 0.00% NA
Indica II  465 84.90% 15.10% 0.00% 0.00% NA
Indica III  913 67.10% 32.90% 0.00% 0.00% NA
Indica Intermediate  786 84.10% 15.80% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 81.50% 18.50% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432416194 C -> DEL N N silent_mutation Average:75.381; most accessible tissue: Callus, score: 95.353 N N N N
vg0432416194 C -> T LOC_Os04g54500.1 upstream_gene_variant ; 2169.0bp to feature; MODIFIER silent_mutation Average:75.381; most accessible tissue: Callus, score: 95.353 N N N N
vg0432416194 C -> T LOC_Os04g54474.1 downstream_gene_variant ; 4129.0bp to feature; MODIFIER silent_mutation Average:75.381; most accessible tissue: Callus, score: 95.353 N N N N
vg0432416194 C -> T LOC_Os04g54490.1 downstream_gene_variant ; 581.0bp to feature; MODIFIER silent_mutation Average:75.381; most accessible tissue: Callus, score: 95.353 N N N N
vg0432416194 C -> T LOC_Os04g54474.2 downstream_gene_variant ; 4129.0bp to feature; MODIFIER silent_mutation Average:75.381; most accessible tissue: Callus, score: 95.353 N N N N
vg0432416194 C -> T LOC_Os04g54474.3 downstream_gene_variant ; 4129.0bp to feature; MODIFIER silent_mutation Average:75.381; most accessible tissue: Callus, score: 95.353 N N N N
vg0432416194 C -> T LOC_Os04g54490-LOC_Os04g54500 intergenic_region ; MODIFIER silent_mutation Average:75.381; most accessible tissue: Callus, score: 95.353 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432416194 NA 8.09E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 NA 2.36E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 3.96E-07 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 NA 1.05E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 1.26E-06 NA mr1086 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 5.61E-06 NA mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 5.82E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 NA 3.46E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 1.81E-06 8.18E-09 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 3.13E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 6.55E-06 6.79E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 1.04E-08 5.18E-13 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 3.69E-09 4.78E-11 mr1800 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 2.39E-06 2.39E-06 mr1862 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 NA 2.24E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 NA 2.12E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 NA 8.54E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 NA 2.83E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 NA 8.65E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 NA 2.54E-07 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 NA 1.38E-07 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 NA 5.30E-09 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 1.14E-08 8.93E-15 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 4.02E-07 NA mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 NA 9.64E-06 mr1784_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 8.84E-07 6.49E-09 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 6.16E-17 2.13E-26 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 9.33E-14 4.04E-15 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 NA 1.03E-10 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432416194 3.33E-06 NA mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251