Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432206092:

Variant ID: vg0432206092 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32206092
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.28, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

AACTAATTCGGCAAATCCTAATTGTGAAAAATTTTGTCCTTTGAGTGCGAGTCTAAGTCGTGCCGTGGATCTCAATTCAAATCCCGTTGTTCCCTCTCAT[C/T]
GAAATCAAAATCCCCCGCCTCAAATTTCCTCTACCAATTCAAGTCTCCGAAATCTAATTCCGAAAGTCAATCCCTTCCTTTGAATCCTCGCCAAATACAT

Reverse complement sequence

ATGTATTTGGCGAGGATTCAAAGGAAGGGATTGACTTTCGGAATTAGATTTCGGAGACTTGAATTGGTAGAGGAAATTTGAGGCGGGGGATTTTGATTTC[G/A]
ATGAGAGGGAACAACGGGATTTGAATTGAGATCCACGGCACGACTTAGACTCGCACTCAAAGGACAAAATTTTTCACAATTAGGATTTGCCGAATTAGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.30%	9.40%	0.53%	67.77%	NA
All Indica	2759	5.10%	1.40%	0.29%	93.15%	NA
All Japonica	1512	57.20%	9.30%	0.33%	33.20%	NA
Aus	269	5.60%	71.00%	2.97%	20.45%	NA
Indica I	595	12.10%	0.50%	0.00%	87.39%	NA
Indica II	465	3.00%	0.40%	0.00%	96.56%	NA
Indica III	913	1.00%	1.80%	0.11%	97.15%	NA
Indica Intermediate	786	5.90%	2.40%	0.89%	90.84%	NA
Temperate Japonica	767	92.60%	0.90%	0.00%	6.52%	NA
Tropical Japonica	504	13.70%	23.40%	0.20%	62.70%	NA
Japonica Intermediate	241	35.70%	6.20%	1.66%	56.43%	NA
VI/Aromatic	96	8.30%	63.50%	1.04%	27.08%	NA
Intermediate	90	30.00%	11.10%	3.33%	55.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432206092	C -> DEL	N	N	silent_mutation	Average:7.576; most accessible tissue: Callus, score: 18.475	N	N	N	N
vg0432206092	C -> T	LOC_Os04g54020.1	upstream_gene_variant ; 3371.0bp to feature; MODIFIER	silent_mutation	Average:7.576; most accessible tissue: Callus, score: 18.475	N	N	N	N
vg0432206092	C -> T	LOC_Os04g54050.1	upstream_gene_variant ; 2813.0bp to feature; MODIFIER	silent_mutation	Average:7.576; most accessible tissue: Callus, score: 18.475	N	N	N	N
vg0432206092	C -> T	LOC_Os04g54030.1	downstream_gene_variant ; 289.0bp to feature; MODIFIER	silent_mutation	Average:7.576; most accessible tissue: Callus, score: 18.475	N	N	N	N
vg0432206092	C -> T	LOC_Os04g54040.1	downstream_gene_variant ; 569.0bp to feature; MODIFIER	silent_mutation	Average:7.576; most accessible tissue: Callus, score: 18.475	N	N	N	N
vg0432206092	C -> T	LOC_Os04g54030-LOC_Os04g54040	intergenic_region ; MODIFIER	silent_mutation	Average:7.576; most accessible tissue: Callus, score: 18.475	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432206092	NA	4.41E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092	8.66E-06	2.99E-10	mr1073	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092	NA	6.81E-07	mr1153	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092	NA	4.79E-09	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092	NA	6.06E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092	NA	6.70E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092	NA	2.25E-06	mr1353	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092	NA	3.42E-09	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092	NA	4.31E-06	mr1367	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092	NA	7.57E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092	NA	6.23E-06	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092	NA	1.59E-12	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092	NA	8.61E-07	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092	NA	1.78E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251