\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432206092:

Variant ID: vg0432206092 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32206092
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.28, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


AACTAATTCGGCAAATCCTAATTGTGAAAAATTTTGTCCTTTGAGTGCGAGTCTAAGTCGTGCCGTGGATCTCAATTCAAATCCCGTTGTTCCCTCTCAT[C/T]
GAAATCAAAATCCCCCGCCTCAAATTTCCTCTACCAATTCAAGTCTCCGAAATCTAATTCCGAAAGTCAATCCCTTCCTTTGAATCCTCGCCAAATACAT

Reverse complement sequence

ATGTATTTGGCGAGGATTCAAAGGAAGGGATTGACTTTCGGAATTAGATTTCGGAGACTTGAATTGGTAGAGGAAATTTGAGGCGGGGGATTTTGATTTC[G/A]
ATGAGAGGGAACAACGGGATTTGAATTGAGATCCACGGCACGACTTAGACTCGCACTCAAAGGACAAAATTTTTCACAATTAGGATTTGCCGAATTAGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.30% 9.40% 0.53% 67.77% NA
All Indica  2759 5.10% 1.40% 0.29% 93.15% NA
All Japonica  1512 57.20% 9.30% 0.33% 33.20% NA
Aus  269 5.60% 71.00% 2.97% 20.45% NA
Indica I  595 12.10% 0.50% 0.00% 87.39% NA
Indica II  465 3.00% 0.40% 0.00% 96.56% NA
Indica III  913 1.00% 1.80% 0.11% 97.15% NA
Indica Intermediate  786 5.90% 2.40% 0.89% 90.84% NA
Temperate Japonica  767 92.60% 0.90% 0.00% 6.52% NA
Tropical Japonica  504 13.70% 23.40% 0.20% 62.70% NA
Japonica Intermediate  241 35.70% 6.20% 1.66% 56.43% NA
VI/Aromatic  96 8.30% 63.50% 1.04% 27.08% NA
Intermediate  90 30.00% 11.10% 3.33% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432206092 C -> DEL N N silent_mutation Average:7.576; most accessible tissue: Callus, score: 18.475 N N N N
vg0432206092 C -> T LOC_Os04g54020.1 upstream_gene_variant ; 3371.0bp to feature; MODIFIER silent_mutation Average:7.576; most accessible tissue: Callus, score: 18.475 N N N N
vg0432206092 C -> T LOC_Os04g54050.1 upstream_gene_variant ; 2813.0bp to feature; MODIFIER silent_mutation Average:7.576; most accessible tissue: Callus, score: 18.475 N N N N
vg0432206092 C -> T LOC_Os04g54030.1 downstream_gene_variant ; 289.0bp to feature; MODIFIER silent_mutation Average:7.576; most accessible tissue: Callus, score: 18.475 N N N N
vg0432206092 C -> T LOC_Os04g54040.1 downstream_gene_variant ; 569.0bp to feature; MODIFIER silent_mutation Average:7.576; most accessible tissue: Callus, score: 18.475 N N N N
vg0432206092 C -> T LOC_Os04g54030-LOC_Os04g54040 intergenic_region ; MODIFIER silent_mutation Average:7.576; most accessible tissue: Callus, score: 18.475 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432206092 NA 4.41E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092 8.66E-06 2.99E-10 mr1073 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092 NA 6.81E-07 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092 NA 4.79E-09 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092 NA 6.06E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092 NA 6.70E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092 NA 2.25E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092 NA 3.42E-09 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092 NA 4.31E-06 mr1367 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092 NA 7.57E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092 NA 6.23E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092 NA 1.59E-12 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092 NA 8.61E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432206092 NA 1.78E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251