\
| Variant ID: vg0432206092 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32206092 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.28, others allele: 0.00, population size: 72. )
AACTAATTCGGCAAATCCTAATTGTGAAAAATTTTGTCCTTTGAGTGCGAGTCTAAGTCGTGCCGTGGATCTCAATTCAAATCCCGTTGTTCCCTCTCAT[C/T]
GAAATCAAAATCCCCCGCCTCAAATTTCCTCTACCAATTCAAGTCTCCGAAATCTAATTCCGAAAGTCAATCCCTTCCTTTGAATCCTCGCCAAATACAT
ATGTATTTGGCGAGGATTCAAAGGAAGGGATTGACTTTCGGAATTAGATTTCGGAGACTTGAATTGGTAGAGGAAATTTGAGGCGGGGGATTTTGATTTC[G/A]
ATGAGAGGGAACAACGGGATTTGAATTGAGATCCACGGCACGACTTAGACTCGCACTCAAAGGACAAAATTTTTCACAATTAGGATTTGCCGAATTAGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 22.30% | 9.40% | 0.53% | 67.77% | NA |
| All Indica | 2759 | 5.10% | 1.40% | 0.29% | 93.15% | NA |
| All Japonica | 1512 | 57.20% | 9.30% | 0.33% | 33.20% | NA |
| Aus | 269 | 5.60% | 71.00% | 2.97% | 20.45% | NA |
| Indica I | 595 | 12.10% | 0.50% | 0.00% | 87.39% | NA |
| Indica II | 465 | 3.00% | 0.40% | 0.00% | 96.56% | NA |
| Indica III | 913 | 1.00% | 1.80% | 0.11% | 97.15% | NA |
| Indica Intermediate | 786 | 5.90% | 2.40% | 0.89% | 90.84% | NA |
| Temperate Japonica | 767 | 92.60% | 0.90% | 0.00% | 6.52% | NA |
| Tropical Japonica | 504 | 13.70% | 23.40% | 0.20% | 62.70% | NA |
| Japonica Intermediate | 241 | 35.70% | 6.20% | 1.66% | 56.43% | NA |
| VI/Aromatic | 96 | 8.30% | 63.50% | 1.04% | 27.08% | NA |
| Intermediate | 90 | 30.00% | 11.10% | 3.33% | 55.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432206092 | C -> DEL | N | N | silent_mutation | Average:7.576; most accessible tissue: Callus, score: 18.475 | N | N | N | N |
| vg0432206092 | C -> T | LOC_Os04g54020.1 | upstream_gene_variant ; 3371.0bp to feature; MODIFIER | silent_mutation | Average:7.576; most accessible tissue: Callus, score: 18.475 | N | N | N | N |
| vg0432206092 | C -> T | LOC_Os04g54050.1 | upstream_gene_variant ; 2813.0bp to feature; MODIFIER | silent_mutation | Average:7.576; most accessible tissue: Callus, score: 18.475 | N | N | N | N |
| vg0432206092 | C -> T | LOC_Os04g54030.1 | downstream_gene_variant ; 289.0bp to feature; MODIFIER | silent_mutation | Average:7.576; most accessible tissue: Callus, score: 18.475 | N | N | N | N |
| vg0432206092 | C -> T | LOC_Os04g54040.1 | downstream_gene_variant ; 569.0bp to feature; MODIFIER | silent_mutation | Average:7.576; most accessible tissue: Callus, score: 18.475 | N | N | N | N |
| vg0432206092 | C -> T | LOC_Os04g54030-LOC_Os04g54040 | intergenic_region ; MODIFIER | silent_mutation | Average:7.576; most accessible tissue: Callus, score: 18.475 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432206092 | NA | 4.41E-07 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432206092 | 8.66E-06 | 2.99E-10 | mr1073 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432206092 | NA | 6.81E-07 | mr1153 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432206092 | NA | 4.79E-09 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432206092 | NA | 6.06E-06 | mr1331 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432206092 | NA | 6.70E-07 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432206092 | NA | 2.25E-06 | mr1353 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432206092 | NA | 3.42E-09 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432206092 | NA | 4.31E-06 | mr1367 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432206092 | NA | 7.57E-07 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432206092 | NA | 6.23E-06 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432206092 | NA | 1.59E-12 | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432206092 | NA | 8.61E-07 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432206092 | NA | 1.78E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |