| Variant ID: vg0432050351 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 32050351 |
| Reference Allele: GT | Alternative Allele: TT,G |
| Primary Allele: GT | Secondary Allele: TT |
Inferred Ancestral Allele: Not determined.
AGTACTAGATGTGACATATCCTAATACTATGAATCTGAATATATCTCTATCCAGATTCGTTATACTAAATGTATCATAATCAGTTATAGATTTTTTTTTT[GT/TT,G]
ACGAAGGGAGTAGTTTTGTTTTTTACTTGGTCAGCCTGATGGTAATGACAGAAAGAACTGGTGGAAGCCGGTGTACGAGGCACTCTGAACGTGATGAGGT
ACCTCATCACGTTCAGAGTGCCTCGTACACCGGCTTCCACCAGTTCTTTCTGTCATTACCATCAGGCTGACCAAGTAAAAAACAAAACTACTCCCTTCGT[AC/AA,C]
AAAAAAAAAATCTATAACTGATTATGATACATTTAGTATAACGAATCTGGATAGAGATATATTCAGATTCATAGTATTAGGATATGTCACATCTAGTACT
| Populations | Population Size | Frequency of GT(primary allele) | Frequency of TT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.00% | 3.90% | 9.31% | 38.85% | G: 0.95% |
| All Indica | 2759 | 29.50% | 0.80% | 14.10% | 54.84% | G: 0.76% |
| All Japonica | 1512 | 71.80% | 8.40% | 1.59% | 16.73% | G: 1.52% |
| Aus | 269 | 81.80% | 1.10% | 4.46% | 12.64% | NA |
| Indica I | 595 | 20.70% | 0.70% | 14.96% | 63.70% | NA |
| Indica II | 465 | 14.20% | 0.40% | 16.99% | 68.39% | NA |
| Indica III | 913 | 44.50% | 1.30% | 15.01% | 37.90% | G: 1.31% |
| Indica Intermediate | 786 | 27.70% | 0.60% | 10.69% | 59.80% | G: 1.15% |
| Temperate Japonica | 767 | 94.10% | 2.90% | 1.04% | 1.96% | NA |
| Tropical Japonica | 504 | 29.80% | 19.60% | 2.18% | 44.05% | G: 4.37% |
| Japonica Intermediate | 241 | 88.40% | 2.50% | 2.07% | 6.64% | G: 0.41% |
| VI/Aromatic | 96 | 54.20% | 34.40% | 6.25% | 5.21% | NA |
| Intermediate | 90 | 54.40% | 0.00% | 10.00% | 34.44% | G: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432050351 | GT -> DEL | N | N | silent_mutation | Average:39.355; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0432050351 | GT -> G | LOC_Os04g53770.1 | downstream_gene_variant ; 1644.0bp to feature; MODIFIER | silent_mutation | Average:39.355; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0432050351 | GT -> G | LOC_Os04g53790.1 | downstream_gene_variant ; 1984.0bp to feature; MODIFIER | silent_mutation | Average:39.355; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0432050351 | GT -> G | LOC_Os04g53780.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.355; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0432050351 | GT -> G | LOC_Os04g53780.2 | intron_variant ; MODIFIER | silent_mutation | Average:39.355; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0432050351 | GT -> TT | LOC_Os04g53770.1 | downstream_gene_variant ; 1643.0bp to feature; MODIFIER | silent_mutation | Average:39.355; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0432050351 | GT -> TT | LOC_Os04g53790.1 | downstream_gene_variant ; 1985.0bp to feature; MODIFIER | silent_mutation | Average:39.355; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0432050351 | GT -> TT | LOC_Os04g53780.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.355; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0432050351 | GT -> TT | LOC_Os04g53780.2 | intron_variant ; MODIFIER | silent_mutation | Average:39.355; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432050351 | NA | 2.79E-08 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432050351 | NA | 2.94E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432050351 | 8.27E-06 | 5.10E-08 | mr1107 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432050351 | NA | 3.84E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432050351 | NA | 6.90E-08 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432050351 | NA | 2.26E-06 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432050351 | NA | 6.15E-06 | mr1103_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432050351 | NA | 2.63E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |