Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0432025550:

Variant ID: vg0432025550 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32025550
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTATGAGCTGTTCTTAGTCTCTTATAGAATGTGCTGTGGTCTTAATCTCTGAAGGCTGAGCTGTGTTAGATTGGAGCACTCCGATCCAACTCTTTTGCCC[A/G]
CCAAATCAACTTACCAATGCCTGTTAGATAGATCTCTCTCCCCTTGAGCCCAACGGCTCAAGGGGGCCTTGACCGCGCCCTGATCGGGGGCGCCCAGCCC

Reverse complement sequence

GGGCTGGGCGCCCCCGATCAGGGCGCGGTCAAGGCCCCCTTGAGCCGTTGGGCTCAAGGGGAGAGAGATCTATCTAACAGGCATTGGTAAGTTGATTTGG[T/C]
GGGCAAAAGAGTTGGATCGGAGTGCTCCAATCTAACACAGCTCAGCCTTCAGAGATTAAGACCACAGCACATTCTATAAGAGACTAAGAACAGCTCATAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.00%	12.00%	4.99%	17.99%	NA
All Indica	2759	42.00%	20.40%	8.26%	29.36%	NA
All Japonica	1512	97.90%	0.20%	0.13%	1.79%	NA
Aus	269	98.50%	0.40%	0.37%	0.74%	NA
Indica I	595	32.60%	9.10%	5.71%	52.61%	NA
Indica II	465	67.10%	12.00%	1.51%	19.35%	NA
Indica III	913	31.20%	37.60%	13.80%	17.42%	NA
Indica Intermediate	786	46.70%	14.00%	7.76%	31.55%	NA
Temperate Japonica	767	99.70%	0.10%	0.00%	0.13%	NA
Tropical Japonica	504	94.80%	0.20%	0.00%	4.96%	NA
Japonica Intermediate	241	98.30%	0.40%	0.83%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	81.10%	2.20%	5.56%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432025550	A -> DEL	N	N	silent_mutation	Average:40.788; most accessible tissue: Minghui63 flower, score: 73.443	N	N	N	N
vg0432025550	A -> G	LOC_Os04g53740.1	upstream_gene_variant ; 2823.0bp to feature; MODIFIER	silent_mutation	Average:40.788; most accessible tissue: Minghui63 flower, score: 73.443	N	N	N	N
vg0432025550	A -> G	LOC_Os04g53750.1	intron_variant ; MODIFIER	silent_mutation	Average:40.788; most accessible tissue: Minghui63 flower, score: 73.443	N	N	N	N
vg0432025550	A -> G	LOC_Os04g53750.3	intron_variant ; MODIFIER	silent_mutation	Average:40.788; most accessible tissue: Minghui63 flower, score: 73.443	N	N	N	N
vg0432025550	A -> G	LOC_Os04g53750.4	intron_variant ; MODIFIER	silent_mutation	Average:40.788; most accessible tissue: Minghui63 flower, score: 73.443	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432025550	NA	2.79E-06	mr1297	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550	NA	3.92E-07	mr1345	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550	NA	8.13E-07	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550	NA	2.73E-06	mr1380	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550	NA	4.63E-07	mr1427	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550	7.29E-06	2.41E-06	mr1427	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550	NA	5.93E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550	NA	2.04E-07	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550	NA	1.38E-06	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550	NA	4.10E-06	mr1573	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550	NA	2.65E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550	NA	8.69E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550	NA	3.81E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251