\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432025550:

Variant ID: vg0432025550 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32025550
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTATGAGCTGTTCTTAGTCTCTTATAGAATGTGCTGTGGTCTTAATCTCTGAAGGCTGAGCTGTGTTAGATTGGAGCACTCCGATCCAACTCTTTTGCCC[A/G]
CCAAATCAACTTACCAATGCCTGTTAGATAGATCTCTCTCCCCTTGAGCCCAACGGCTCAAGGGGGCCTTGACCGCGCCCTGATCGGGGGCGCCCAGCCC

Reverse complement sequence

GGGCTGGGCGCCCCCGATCAGGGCGCGGTCAAGGCCCCCTTGAGCCGTTGGGCTCAAGGGGAGAGAGATCTATCTAACAGGCATTGGTAAGTTGATTTGG[T/C]
GGGCAAAAGAGTTGGATCGGAGTGCTCCAATCTAACACAGCTCAGCCTTCAGAGATTAAGACCACAGCACATTCTATAAGAGACTAAGAACAGCTCATAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 12.00% 4.99% 17.99% NA
All Indica  2759 42.00% 20.40% 8.26% 29.36% NA
All Japonica  1512 97.90% 0.20% 0.13% 1.79% NA
Aus  269 98.50% 0.40% 0.37% 0.74% NA
Indica I  595 32.60% 9.10% 5.71% 52.61% NA
Indica II  465 67.10% 12.00% 1.51% 19.35% NA
Indica III  913 31.20% 37.60% 13.80% 17.42% NA
Indica Intermediate  786 46.70% 14.00% 7.76% 31.55% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 94.80% 0.20% 0.00% 4.96% NA
Japonica Intermediate  241 98.30% 0.40% 0.83% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 81.10% 2.20% 5.56% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432025550 A -> DEL N N silent_mutation Average:40.788; most accessible tissue: Minghui63 flower, score: 73.443 N N N N
vg0432025550 A -> G LOC_Os04g53740.1 upstream_gene_variant ; 2823.0bp to feature; MODIFIER silent_mutation Average:40.788; most accessible tissue: Minghui63 flower, score: 73.443 N N N N
vg0432025550 A -> G LOC_Os04g53750.1 intron_variant ; MODIFIER silent_mutation Average:40.788; most accessible tissue: Minghui63 flower, score: 73.443 N N N N
vg0432025550 A -> G LOC_Os04g53750.3 intron_variant ; MODIFIER silent_mutation Average:40.788; most accessible tissue: Minghui63 flower, score: 73.443 N N N N
vg0432025550 A -> G LOC_Os04g53750.4 intron_variant ; MODIFIER silent_mutation Average:40.788; most accessible tissue: Minghui63 flower, score: 73.443 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432025550 NA 2.79E-06 mr1297 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550 NA 3.92E-07 mr1345 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550 NA 8.13E-07 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550 NA 2.73E-06 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550 NA 4.63E-07 mr1427 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550 7.29E-06 2.41E-06 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550 NA 5.93E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550 NA 2.04E-07 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550 NA 1.38E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550 NA 4.10E-06 mr1573 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550 NA 2.65E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550 NA 8.69E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432025550 NA 3.81E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251