\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431958265:

Variant ID: vg0431958265 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31958265
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, A: 0.01, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GCGGCCGCGGCGGCGTCCTCCCCCTCCGCGTCCGCGAACGCGTCGAACGTCCCCGCCGGCAGGCCGAACTCCTCCGGCGCCCCGGACATCAACTTGCTGC[C/T]
GCTGTTCCCGCCGCCCTCCGCCGCCTGATCCTCCTCGCCGCGGCGGGGGACAAGGTACTTGTTCTTGGACGCCGCGCGGCCCTTGACGTACTTTCCCTTC

Reverse complement sequence

GAAGGGAAAGTACGTCAAGGGCCGCGCGGCGTCCAAGAACAAGTACCTTGTCCCCCGCCGCGGCGAGGAGGATCAGGCGGCGGAGGGCGGCGGGAACAGC[G/A]
GCAGCAAGTTGATGTCCGGGGCGCCGGAGGAGTTCGGCCTGCCGGCGGGGACGTTCGACGCGTTCGCGGACGCGGAGGGGGAGGACGCCGCCGCGGCCGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 40.60% 0.55% 0.00% NA
All Indica  2759 73.50% 25.70% 0.80% 0.00% NA
All Japonica  1512 37.20% 62.70% 0.13% 0.00% NA
Aus  269 37.20% 62.50% 0.37% 0.00% NA
Indica I  595 88.90% 10.90% 0.17% 0.00% NA
Indica II  465 81.10% 17.60% 1.29% 0.00% NA
Indica III  913 63.50% 35.50% 0.99% 0.00% NA
Indica Intermediate  786 69.00% 30.30% 0.76% 0.00% NA
Temperate Japonica  767 52.30% 47.60% 0.13% 0.00% NA
Tropical Japonica  504 16.70% 83.30% 0.00% 0.00% NA
Japonica Intermediate  241 32.00% 67.60% 0.41% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431958265 C -> T LOC_Os04g53606.1 missense_variant ; p.Gly121Ser; MODERATE nonsynonymous_codon ; G121S Average:87.602; most accessible tissue: Zhenshan97 flag leaf, score: 95.494 benign -0.647 TOLERATED 0.79

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431958265 C T 0.0 0.0 0.01 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431958265 1.19E-06 NA mr1122 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431958265 NA 9.98E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431958265 NA 5.70E-06 mr1812 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251