\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431921919:

Variant ID: vg0431921919 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31921919
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


GATTTATATTGTCTCGGCATGGCGACCGATCTATTCCAATCACTTGATTTAAGTATATATCGATACAAAGATTATATATTGTCAATATCTGCAGCCGATC[G/A]
AGTAGATCTAGTCCCTTCTTATTTATTAATGACTGCCGATCGATGTATATATGACATCGGCTCAAAGATAAATGATATGTCATCGGCACCTAGCCGATCG

Reverse complement sequence

CGATCGGCTAGGTGCCGATGACATATCATTTATCTTTGAGCCGATGTCATATATACATCGATCGGCAGTCATTAATAAATAAGAAGGGACTAGATCTACT[C/T]
GATCGGCTGCAGATATTGACAATATATAATCTTTGTATCGATATATACTTAAATCAAGTGATTGGAATAGATCGGTCGCCATGCCGAGACAATATAAATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 27.30% 0.38% 0.00% NA
All Indica  2759 55.80% 43.70% 0.51% 0.00% NA
All Japonica  1512 97.90% 2.00% 0.13% 0.00% NA
Aus  269 86.20% 13.80% 0.00% 0.00% NA
Indica I  595 38.80% 61.00% 0.17% 0.00% NA
Indica II  465 75.10% 24.90% 0.00% 0.00% NA
Indica III  913 55.90% 43.80% 0.33% 0.00% NA
Indica Intermediate  786 57.10% 41.60% 1.27% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 95.20% 4.80% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431921919 G -> A LOC_Os04g53550.1 downstream_gene_variant ; 3736.0bp to feature; MODIFIER silent_mutation Average:25.337; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0431921919 G -> A LOC_Os04g53544-LOC_Os04g53550 intergenic_region ; MODIFIER silent_mutation Average:25.337; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431921919 2.25E-06 NA mr1189_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431921919 NA 8.48E-07 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251