\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431915066:

Variant ID: vg0431915066 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31915066
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.25, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:


CCAAAAAATAAAGCTTCTTATAACAAATTAATATATAGTTATAACTGTGTAATTACAAACTGTCTAAAATTAATTTCACATTGTAAATTATATGGCAGAA[A/G]
CATTTTTTTTTTCAATTTGCAACCCAACAGTACGTGCTAGCTGTCCCAAAAAAACAAGGTTGCTTTTCTTGAGCTAGCTTAGCACTGGCTGTCTCTGGCT

Reverse complement sequence

AGCCAGAGACAGCCAGTGCTAAGCTAGCTCAAGAAAAGCAACCTTGTTTTTTTGGGACAGCTAGCACGTACTGTTGGGTTGCAAATTGAAAAAAAAAATG[T/C]
TTCTGCCATATAATTTACAATGTGAAATTAATTTTAGACAGTTTGTAATTACACAGTTATAACTATATATTAATTTGTTATAAGAAGCTTTATTTTTTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.30% 45.10% 1.59% 0.00% NA
All Indica  2759 57.20% 40.60% 2.28% 0.00% NA
All Japonica  1512 53.20% 46.60% 0.20% 0.00% NA
Aus  269 23.80% 74.00% 2.23% 0.00% NA
Indica I  595 79.20% 18.00% 2.86% 0.00% NA
Indica II  465 45.60% 54.20% 0.22% 0.00% NA
Indica III  913 49.20% 49.80% 0.99% 0.00% NA
Indica Intermediate  786 56.60% 38.80% 4.58% 0.00% NA
Temperate Japonica  767 81.90% 17.70% 0.39% 0.00% NA
Tropical Japonica  504 17.50% 82.50% 0.00% 0.00% NA
Japonica Intermediate  241 36.90% 63.10% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 53.30% 43.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431915066 A -> G LOC_Os04g53544.1 upstream_gene_variant ; 4499.0bp to feature; MODIFIER silent_mutation Average:81.402; most accessible tissue: Callus, score: 89.493 N N N N
vg0431915066 A -> G LOC_Os04g53544-LOC_Os04g53550 intergenic_region ; MODIFIER silent_mutation Average:81.402; most accessible tissue: Callus, score: 89.493 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431915066 NA 3.31E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431915066 NA 1.35E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431915066 NA 9.64E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431915066 NA 4.25E-06 mr1003 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 2.05E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 5.50E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 1.20E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 9.20E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 3.52E-06 4.92E-08 mr1788 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 2.37E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 1.57E-07 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 1.22E-07 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 3.26E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 7.36E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 1.13E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 3.05E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 1.23E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 4.22E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 4.46E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 6.74E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066 NA 1.39E-09 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251