Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431915066:

Variant ID: vg0431915066 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 31915066
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.25, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:

CCAAAAAATAAAGCTTCTTATAACAAATTAATATATAGTTATAACTGTGTAATTACAAACTGTCTAAAATTAATTTCACATTGTAAATTATATGGCAGAA[A/G]
CATTTTTTTTTTCAATTTGCAACCCAACAGTACGTGCTAGCTGTCCCAAAAAAACAAGGTTGCTTTTCTTGAGCTAGCTTAGCACTGGCTGTCTCTGGCT

Reverse complement sequence

AGCCAGAGACAGCCAGTGCTAAGCTAGCTCAAGAAAAGCAACCTTGTTTTTTTGGGACAGCTAGCACGTACTGTTGGGTTGCAAATTGAAAAAAAAAATG[T/C]
TTCTGCCATATAATTTACAATGTGAAATTAATTTTAGACAGTTTGTAATTACACAGTTATAACTATATATTAATTTGTTATAAGAAGCTTTATTTTTTGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.30%	45.10%	1.59%	0.00%	NA
All Indica	2759	57.20%	40.60%	2.28%	0.00%	NA
All Japonica	1512	53.20%	46.60%	0.20%	0.00%	NA
Aus	269	23.80%	74.00%	2.23%	0.00%	NA
Indica I	595	79.20%	18.00%	2.86%	0.00%	NA
Indica II	465	45.60%	54.20%	0.22%	0.00%	NA
Indica III	913	49.20%	49.80%	0.99%	0.00%	NA
Indica Intermediate	786	56.60%	38.80%	4.58%	0.00%	NA
Temperate Japonica	767	81.90%	17.70%	0.39%	0.00%	NA
Tropical Japonica	504	17.50%	82.50%	0.00%	0.00%	NA
Japonica Intermediate	241	36.90%	63.10%	0.00%	0.00%	NA
VI/Aromatic	96	25.00%	75.00%	0.00%	0.00%	NA
Intermediate	90	53.30%	43.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431915066	A -> G	LOC_Os04g53544.1	upstream_gene_variant ; 4499.0bp to feature; MODIFIER	silent_mutation	Average:81.402; most accessible tissue: Callus, score: 89.493	N	N	N	N
vg0431915066	A -> G	LOC_Os04g53544-LOC_Os04g53550	intergenic_region ; MODIFIER	silent_mutation	Average:81.402; most accessible tissue: Callus, score: 89.493	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431915066	NA	3.31E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431915066	NA	1.35E-13	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431915066	NA	9.64E-13	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431915066	NA	4.25E-06	mr1003	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	2.05E-06	mr1010	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	5.50E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	1.20E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	9.20E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	3.52E-06	4.92E-08	mr1788	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	2.37E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	1.57E-07	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	1.22E-07	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	3.26E-07	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	7.36E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	1.13E-08	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	3.05E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	1.23E-08	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	4.22E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	4.46E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	6.74E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915066	NA	1.39E-09	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251