| Variant ID: vg0431893641 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31893641 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.56, A: 0.44, others allele: 0.00, population size: 97. )
AGGTCATGCAAAAAATTAATAGCATAGGATGCCACGTCCTCGTTTAGGTGGAACAGCCATGTCATCTCACGGTGGATTTATTCATTGATAGTGTGGTTTT[A/G]
TAAAACAACACTACCGAAATATATGTACTTAAATGCCAAGTATCAAAGTGTGTAGTTTTCTGCAACATAGACCACAAAACGTATAGTTTTGTGAAATTTA
TAAATTTCACAAAACTATACGTTTTGTGGTCTATGTTGCAGAAAACTACACACTTTGATACTTGGCATTTAAGTACATATATTTCGGTAGTGTTGTTTTA[T/C]
AAAACCACACTATCAATGAATAAATCCACCGTGAGATGACATGGCTGTTCCACCTAAACGAGGACGTGGCATCCTATGCTATTAATTTTTTGCATGACCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.70% | 41.40% | 4.97% | 7.93% | NA |
| All Indica | 2759 | 40.70% | 38.20% | 8.12% | 13.01% | NA |
| All Japonica | 1512 | 45.00% | 54.60% | 0.33% | 0.13% | NA |
| Aus | 269 | 86.60% | 8.60% | 1.12% | 3.72% | NA |
| Indica I | 595 | 49.60% | 28.90% | 8.24% | 13.28% | NA |
| Indica II | 465 | 43.70% | 35.90% | 4.95% | 15.48% | NA |
| Indica III | 913 | 33.20% | 44.50% | 10.19% | 12.16% | NA |
| Indica Intermediate | 786 | 40.80% | 39.30% | 7.51% | 12.34% | NA |
| Temperate Japonica | 767 | 11.60% | 88.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 86.30% | 12.90% | 0.40% | 0.40% | NA |
| Japonica Intermediate | 241 | 64.70% | 34.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 8.30% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 44.40% | 50.00% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431893641 | A -> DEL | N | N | silent_mutation | Average:52.35; most accessible tissue: Callus, score: 84.366 | N | N | N | N |
| vg0431893641 | A -> G | LOC_Os04g53530.1 | upstream_gene_variant ; 1611.0bp to feature; MODIFIER | silent_mutation | Average:52.35; most accessible tissue: Callus, score: 84.366 | N | N | N | N |
| vg0431893641 | A -> G | LOC_Os04g53520.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.35; most accessible tissue: Callus, score: 84.366 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431893641 | NA | 8.37E-12 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0431893641 | NA | 1.80E-13 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0431893641 | NA | 4.24E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431893641 | NA | 2.18E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431893641 | NA | 6.32E-07 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431893641 | NA | 3.75E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431893641 | NA | 4.31E-06 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431893641 | NA | 2.22E-07 | mr1212_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431893641 | NA | 3.25E-07 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |