\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431872453:

Variant ID: vg0431872453 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31872453
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, T: 0.28, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


CCCGTTGACGCCCTCAACGATTTTCACCCGCTGTTGCCCGGGAGTTTTCACCAGCTCAAGACTGTCTTTACTAAGTCATACCAAAACTTAACACGTCACT[T/G]
TCTTGCTGCATGCATCAATTTCCTTCTTTGCATATGCCATTGCTCACAAGATCCAAGCATGTGCACTGGACATACACGTGTCCATCCCTCACATGTCCAC

Reverse complement sequence

GTGGACATGTGAGGGATGGACACGTGTATGTCCAGTGCACATGCTTGGATCTTGTGAGCAATGGCATATGCAAAGAAGGAAATTGATGCATGCAGCAAGA[A/C]
AGTGACGTGTTAAGTTTTGGTATGACTTAGTAAAGACAGTCTTGAGCTGGTGAAAACTCCCGGGCAACAGCGGGTGAAAATCGTTGAGGGCGTCAACGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.20% 29.90% 1.52% 23.32% NA
All Indica  2759 41.20% 19.40% 1.96% 37.44% NA
All Japonica  1512 45.00% 51.80% 0.93% 2.25% NA
Aus  269 82.90% 15.20% 1.12% 0.74% NA
Indica I  595 29.60% 15.50% 1.51% 53.45% NA
Indica II  465 65.80% 12.00% 0.43% 21.72% NA
Indica III  913 35.20% 27.80% 2.52% 34.50% NA
Indica Intermediate  786 42.50% 16.90% 2.54% 38.04% NA
Temperate Japonica  767 13.70% 85.00% 0.52% 0.78% NA
Tropical Japonica  504 83.70% 9.70% 1.79% 4.76% NA
Japonica Intermediate  241 63.90% 34.00% 0.41% 1.66% NA
VI/Aromatic  96 56.20% 22.90% 1.04% 19.79% NA
Intermediate  90 47.80% 36.70% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431872453 T -> DEL N N silent_mutation Average:54.684; most accessible tissue: Callus, score: 98.617 N N N N
vg0431872453 T -> G LOC_Os04g53510.1 downstream_gene_variant ; 3272.0bp to feature; MODIFIER silent_mutation Average:54.684; most accessible tissue: Callus, score: 98.617 N N N N
vg0431872453 T -> G LOC_Os04g53496-LOC_Os04g53510 intergenic_region ; MODIFIER silent_mutation Average:54.684; most accessible tissue: Callus, score: 98.617 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431872453 T G 0.08 0.03 -0.02 -0.01 -0.02 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431872453 NA 1.50E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431872453 NA 4.22E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431872453 NA 3.39E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 6.27E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 2.13E-06 4.72E-08 mr1318 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 5.89E-07 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 2.55E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 3.95E-07 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 7.51E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 1.81E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 4.18E-06 mr1788 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 6.51E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 3.86E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 6.24E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 4.56E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 2.32E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 1.73E-12 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 6.87E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 9.27E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431872453 NA 1.62E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251