\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431634180:

Variant ID: vg0431634180 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31634180
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTCCGTTGCATGTCGCACGTCACCCAGATCGGCGTCGCTCCAAGATTGGCGTCACGGTCGCGGGCGTCGATCTCGCTCCCCTATCGGCATCGCAATCAC[T/C]
GGCGATGATATCGTGGCCTCGAACCTTCGTAGCTGTCTCCATCGCCTTCGCCGCTGCTGATCCTGCTTCCCCAGTTCGCCGTCGTCGCCTTCGATCCGGC

Reverse complement sequence

GCCGGATCGAAGGCGACGACGGCGAACTGGGGAAGCAGGATCAGCAGCGGCGAAGGCGATGGAGACAGCTACGAAGGTTCGAGGCCACGATATCATCGCC[A/G]
GTGATTGCGATGCCGATAGGGGAGCGAGATCGACGCCCGCGACCGTGACGCCAATCTTGGAGCGACGCCGATCTGGGTGACGTGCGACATGCAACGGAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 6.80% 2.01% 33.73% NA
All Indica  2759 47.50% 9.10% 2.65% 40.74% NA
All Japonica  1512 75.80% 1.30% 1.06% 21.83% NA
Aus  269 54.30% 13.00% 2.23% 30.48% NA
Indica I  595 68.40% 6.60% 1.51% 23.53% NA
Indica II  465 57.80% 10.10% 2.58% 29.46% NA
Indica III  913 26.20% 6.70% 2.96% 64.18% NA
Indica Intermediate  786 50.30% 13.40% 3.18% 33.21% NA
Temperate Japonica  767 95.40% 2.00% 0.65% 1.96% NA
Tropical Japonica  504 42.90% 0.00% 1.98% 55.16% NA
Japonica Intermediate  241 82.20% 2.10% 0.41% 15.35% NA
VI/Aromatic  96 59.40% 5.20% 0.00% 35.42% NA
Intermediate  90 61.10% 12.20% 0.00% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431634180 T -> C LOC_Os04g53120.1 upstream_gene_variant ; 3919.0bp to feature; MODIFIER silent_mutation Average:72.451; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N
vg0431634180 T -> C LOC_Os04g53110.1 downstream_gene_variant ; 749.0bp to feature; MODIFIER silent_mutation Average:72.451; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N
vg0431634180 T -> C LOC_Os04g53110-LOC_Os04g53120 intergenic_region ; MODIFIER silent_mutation Average:72.451; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N
vg0431634180 T -> DEL N N silent_mutation Average:72.451; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431634180 T C 0.0 -0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431634180 NA 7.74E-06 mr1058_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 5.00E-06 mr1084_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 3.23E-06 mr1206_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 3.56E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 6.96E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 6.04E-06 mr1230_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 9.63E-06 mr1248_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 7.77E-06 mr1252_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 9.04E-06 mr1288_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 7.55E-08 mr1388_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 4.44E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 7.51E-06 7.51E-06 mr1455_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 4.83E-06 4.83E-06 mr1487_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 1.49E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 5.59E-06 5.59E-06 mr1596_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 5.93E-06 mr1605_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 3.73E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 8.67E-06 8.67E-06 mr1640_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 1.59E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 8.81E-06 8.80E-06 mr1783_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 7.83E-06 mr1787_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 2.00E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 9.87E-06 mr1837_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 2.23E-07 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 2.59E-06 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 8.75E-06 mr1876_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 3.11E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 6.05E-06 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431634180 NA 1.59E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251