\
| Variant ID: vg0431561696 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31561696 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGTTTGGTTGGAAAGGTAAGTGGATGGGGGTGGGTTTACAAAAGAGAATATTCTCTCGATACACGTGCCCCCCCTCATGTTGTGTTTGGTTGTTGGATGG[A/G]
GCTAGATGGAAGATGCTCGTCTGATTGTTGCTTGTCTTTGGTTGGAGGGCTCGGTAGATGGGGGTGGCTTAGAAAAGAGAATATTTTCTCAATACACTTG
CAAGTGTATTGAGAAAATATTCTCTTTTCTAAGCCACCCCCATCTACCGAGCCCTCCAACCAAAGACAAGCAACAATCAGACGAGCATCTTCCATCTAGC[T/C]
CCATCCAACAACCAAACACAACATGAGGGGGGGCACGTGTATCGAGAGAATATTCTCTTTTGTAAACCCACCCCCATCCACTTACCTTTCCAACCAAACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.60% | 6.60% | 0.80% | 54.93% | NA |
| All Indica | 2759 | 14.60% | 9.90% | 1.16% | 74.34% | NA |
| All Japonica | 1512 | 75.70% | 1.30% | 0.13% | 22.88% | NA |
| Aus | 269 | 53.90% | 3.30% | 0.37% | 42.38% | NA |
| Indica I | 595 | 22.90% | 6.70% | 1.68% | 68.74% | NA |
| Indica II | 465 | 16.60% | 11.80% | 0.22% | 71.40% | NA |
| Indica III | 913 | 5.90% | 8.30% | 0.99% | 84.78% | NA |
| Indica Intermediate | 786 | 17.30% | 13.00% | 1.53% | 68.19% | NA |
| Temperate Japonica | 767 | 92.30% | 1.00% | 0.13% | 6.52% | NA |
| Tropical Japonica | 504 | 46.00% | 2.00% | 0.20% | 51.79% | NA |
| Japonica Intermediate | 241 | 85.10% | 0.40% | 0.00% | 14.52% | NA |
| VI/Aromatic | 96 | 41.70% | 4.20% | 0.00% | 54.17% | NA |
| Intermediate | 90 | 51.10% | 8.90% | 3.33% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431561696 | A -> DEL | N | N | silent_mutation | Average:13.894; most accessible tissue: Callus, score: 89.561 | N | N | N | N |
| vg0431561696 | A -> G | LOC_Os04g53000.1 | upstream_gene_variant ; 3448.0bp to feature; MODIFIER | silent_mutation | Average:13.894; most accessible tissue: Callus, score: 89.561 | N | N | N | N |
| vg0431561696 | A -> G | LOC_Os04g52970.1 | downstream_gene_variant ; 3290.0bp to feature; MODIFIER | silent_mutation | Average:13.894; most accessible tissue: Callus, score: 89.561 | N | N | N | N |
| vg0431561696 | A -> G | LOC_Os04g52980.1 | downstream_gene_variant ; 1623.0bp to feature; MODIFIER | silent_mutation | Average:13.894; most accessible tissue: Callus, score: 89.561 | N | N | N | N |
| vg0431561696 | A -> G | LOC_Os04g52990.1 | downstream_gene_variant ; 680.0bp to feature; MODIFIER | silent_mutation | Average:13.894; most accessible tissue: Callus, score: 89.561 | N | N | N | N |
| vg0431561696 | A -> G | LOC_Os04g52980-LOC_Os04g52990 | intergenic_region ; MODIFIER | silent_mutation | Average:13.894; most accessible tissue: Callus, score: 89.561 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431561696 | NA | 3.48E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431561696 | NA | 4.69E-08 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431561696 | NA | 1.06E-06 | mr1328 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431561696 | NA | 5.81E-08 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431561696 | NA | 1.72E-06 | mr1446 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431561696 | NA | 1.65E-08 | mr1989 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431561696 | NA | 1.29E-06 | mr1989 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |