Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0431561696:

Variant ID: vg0431561696 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 31561696
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTTTGGTTGGAAAGGTAAGTGGATGGGGGTGGGTTTACAAAAGAGAATATTCTCTCGATACACGTGCCCCCCCTCATGTTGTGTTTGGTTGTTGGATGG[A/G]
GCTAGATGGAAGATGCTCGTCTGATTGTTGCTTGTCTTTGGTTGGAGGGCTCGGTAGATGGGGGTGGCTTAGAAAAGAGAATATTTTCTCAATACACTTG

Reverse complement sequence

CAAGTGTATTGAGAAAATATTCTCTTTTCTAAGCCACCCCCATCTACCGAGCCCTCCAACCAAAGACAAGCAACAATCAGACGAGCATCTTCCATCTAGC[T/C]
CCATCCAACAACCAAACACAACATGAGGGGGGGCACGTGTATCGAGAGAATATTCTCTTTTGTAAACCCACCCCCATCCACTTACCTTTCCAACCAAACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.60%	6.60%	0.80%	54.93%	NA
All Indica	2759	14.60%	9.90%	1.16%	74.34%	NA
All Japonica	1512	75.70%	1.30%	0.13%	22.88%	NA
Aus	269	53.90%	3.30%	0.37%	42.38%	NA
Indica I	595	22.90%	6.70%	1.68%	68.74%	NA
Indica II	465	16.60%	11.80%	0.22%	71.40%	NA
Indica III	913	5.90%	8.30%	0.99%	84.78%	NA
Indica Intermediate	786	17.30%	13.00%	1.53%	68.19%	NA
Temperate Japonica	767	92.30%	1.00%	0.13%	6.52%	NA
Tropical Japonica	504	46.00%	2.00%	0.20%	51.79%	NA
Japonica Intermediate	241	85.10%	0.40%	0.00%	14.52%	NA
VI/Aromatic	96	41.70%	4.20%	0.00%	54.17%	NA
Intermediate	90	51.10%	8.90%	3.33%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431561696	A -> DEL	N	N	silent_mutation	Average:13.894; most accessible tissue: Callus, score: 89.561	N	N	N	N
vg0431561696	A -> G	LOC_Os04g53000.1	upstream_gene_variant ; 3448.0bp to feature; MODIFIER	silent_mutation	Average:13.894; most accessible tissue: Callus, score: 89.561	N	N	N	N
vg0431561696	A -> G	LOC_Os04g52970.1	downstream_gene_variant ; 3290.0bp to feature; MODIFIER	silent_mutation	Average:13.894; most accessible tissue: Callus, score: 89.561	N	N	N	N
vg0431561696	A -> G	LOC_Os04g52980.1	downstream_gene_variant ; 1623.0bp to feature; MODIFIER	silent_mutation	Average:13.894; most accessible tissue: Callus, score: 89.561	N	N	N	N
vg0431561696	A -> G	LOC_Os04g52990.1	downstream_gene_variant ; 680.0bp to feature; MODIFIER	silent_mutation	Average:13.894; most accessible tissue: Callus, score: 89.561	N	N	N	N
vg0431561696	A -> G	LOC_Os04g52980-LOC_Os04g52990	intergenic_region ; MODIFIER	silent_mutation	Average:13.894; most accessible tissue: Callus, score: 89.561	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431561696	NA	3.48E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431561696	NA	4.69E-08	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431561696	NA	1.06E-06	mr1328	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431561696	NA	5.81E-08	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431561696	NA	1.72E-06	mr1446	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431561696	NA	1.65E-08	mr1989	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431561696	NA	1.29E-06	mr1989	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251