\
| Variant ID: vg0431078210 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31078210 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 99. )
ATGGATGCTCGACGCTAGAATGGTACTGATCTGACCAAATGGGAAGCTCAGAATCTACTTTACCCTTAGTCATTCACATGGCTTAGCAGCTAAGAACAAG[T/C]
TAAGTCATCATGTATTATCATATCATAAAGTACAAAGAGATCACCTGAGATAAGCTTTGGTTTTAGAAAATCTAGGATGGATACAATAAATACTCCACCA
TGGTGGAGTATTTATTGTATCCATCCTAGATTTTCTAAAACCAAAGCTTATCTCAGGTGATCTCTTTGTACTTTATGATATGATAATACATGATGACTTA[A/G]
CTTGTTCTTAGCTGCTAAGCCATGTGAATGACTAAGGGTAAAGTAGATTCTGAGCTTCCCATTTGGTCAGATCAGTACCATTCTAGCGTCGAGCATCCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.40% | 28.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 25.70% | 74.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 56.10% | 43.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 28.80% | 71.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.00% | 49.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 35.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431078210 | T -> C | LOC_Os04g52310.1 | 3_prime_UTR_variant ; 191.0bp to feature; MODIFIER | silent_mutation | Average:49.447; most accessible tissue: Callus, score: 83.111 | N | N | N | N |
| vg0431078210 | T -> C | LOC_Os04g52290.1 | upstream_gene_variant ; 1866.0bp to feature; MODIFIER | silent_mutation | Average:49.447; most accessible tissue: Callus, score: 83.111 | N | N | N | N |
| vg0431078210 | T -> C | LOC_Os04g52280.1 | downstream_gene_variant ; 2609.0bp to feature; MODIFIER | silent_mutation | Average:49.447; most accessible tissue: Callus, score: 83.111 | N | N | N | N |
| vg0431078210 | T -> C | LOC_Os04g52300.1 | downstream_gene_variant ; 282.0bp to feature; MODIFIER | silent_mutation | Average:49.447; most accessible tissue: Callus, score: 83.111 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431078210 | NA | 1.41E-07 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431078210 | NA | 4.13E-07 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431078210 | 4.61E-08 | NA | mr1100_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431078210 | NA | 3.01E-08 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431078210 | NA | 1.06E-07 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431078210 | NA | 3.88E-08 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431078210 | NA | 4.67E-12 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431078210 | NA | 1.65E-10 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431078210 | NA | 9.76E-11 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431078210 | NA | 1.87E-07 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |