Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0431078210:

Variant ID: vg0431078210 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 31078210
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

ATGGATGCTCGACGCTAGAATGGTACTGATCTGACCAAATGGGAAGCTCAGAATCTACTTTACCCTTAGTCATTCACATGGCTTAGCAGCTAAGAACAAG[T/C]
TAAGTCATCATGTATTATCATATCATAAAGTACAAAGAGATCACCTGAGATAAGCTTTGGTTTTAGAAAATCTAGGATGGATACAATAAATACTCCACCA

Reverse complement sequence

TGGTGGAGTATTTATTGTATCCATCCTAGATTTTCTAAAACCAAAGCTTATCTCAGGTGATCTCTTTGTACTTTATGATATGATAATACATGATGACTTA[A/G]
CTTGTTCTTAGCTGCTAAGCCATGTGAATGACTAAGGGTAAAGTAGATTCTGAGCTTCCCATTTGGTCAGATCAGTACCATTCTAGCGTCGAGCATCCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.40%	28.60%	0.00%	0.00%	NA
All Indica	2759	97.40%	2.60%	0.00%	0.00%	NA
All Japonica	1512	25.70%	74.30%	0.00%	0.00%	NA
Aus	269	56.10%	43.90%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	95.30%	4.70%	0.00%	0.00%	NA
Indica III	913	99.00%	1.00%	0.00%	0.00%	NA
Indica Intermediate	786	95.00%	5.00%	0.00%	0.00%	NA
Temperate Japonica	767	28.80%	71.20%	0.00%	0.00%	NA
Tropical Japonica	504	8.70%	91.30%	0.00%	0.00%	NA
Japonica Intermediate	241	51.00%	49.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	64.40%	35.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431078210	T -> C	LOC_Os04g52310.1	3_prime_UTR_variant ; 191.0bp to feature; MODIFIER	silent_mutation	Average:49.447; most accessible tissue: Callus, score: 83.111	N	N	N	N
vg0431078210	T -> C	LOC_Os04g52290.1	upstream_gene_variant ; 1866.0bp to feature; MODIFIER	silent_mutation	Average:49.447; most accessible tissue: Callus, score: 83.111	N	N	N	N
vg0431078210	T -> C	LOC_Os04g52280.1	downstream_gene_variant ; 2609.0bp to feature; MODIFIER	silent_mutation	Average:49.447; most accessible tissue: Callus, score: 83.111	N	N	N	N
vg0431078210	T -> C	LOC_Os04g52300.1	downstream_gene_variant ; 282.0bp to feature; MODIFIER	silent_mutation	Average:49.447; most accessible tissue: Callus, score: 83.111	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431078210	NA	1.41E-07	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431078210	NA	4.13E-07	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431078210	4.61E-08	NA	mr1100_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431078210	NA	3.01E-08	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431078210	NA	1.06E-07	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431078210	NA	3.88E-08	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431078210	NA	4.67E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431078210	NA	1.65E-10	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431078210	NA	9.76E-11	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431078210	NA	1.87E-07	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251