\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430745099:

Variant ID: vg0430745099 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30745099
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, C: 0.04, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


ACGTACGCCACGCAATCGACATGATGCACCTCACTAAGAACCTTTGCGTAAACCTTCTTGGCTTCTAGGTGTATACGGAAAGTCGAAAGATACACTGGAA[G/C]
CACGTAATGATCTAAAGCATATGGAACAACGCGACGACCTTCACCCGGAACCAAAGGAGAAAGGAAGCCATTACTTGAGTCCAGCCAGCTACACTCTTAG

Reverse complement sequence

CTAAGAGTGTAGCTGGCTGGACTCAAGTAATGGCTTCCTTTCTCCTTTGGTTCCGGGTGAAGGTCGTCGCGTTGTTCCATATGCTTTAGATCATTACGTG[C/G]
TTCCAGTGTATCTTTCGACTTTCCGTATACACCTAGAAGCCAAGAAGGTTTACGCAAAGGTTCTTAGTGAGGTGCATCATGTCGATTGCGTGGCGTACGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 41.60% 2.77% 1.59% NA
All Indica  2759 28.50% 69.60% 1.78% 0.14% NA
All Japonica  1512 89.40% 0.90% 5.09% 4.70% NA
Aus  269 93.70% 5.90% 0.37% 0.00% NA
Indica I  595 4.40% 93.60% 2.02% 0.00% NA
Indica II  465 75.90% 23.90% 0.22% 0.00% NA
Indica III  913 17.60% 78.90% 3.29% 0.22% NA
Indica Intermediate  786 31.40% 67.60% 0.76% 0.25% NA
Temperate Japonica  767 81.60% 0.30% 9.26% 8.87% NA
Tropical Japonica  504 97.80% 1.60% 0.60% 0.00% NA
Japonica Intermediate  241 96.30% 1.20% 1.24% 1.24% NA
VI/Aromatic  96 94.80% 1.00% 4.17% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430745099 G -> C LOC_Os04g51840.1 missense_variant ; p.Ala205Pro; MODERATE nonsynonymous_codon ; A205P Average:21.723; most accessible tissue: Minghui63 young leaf, score: 36.684 possibly damaging 1.702 DELETERIOUS 0.01
vg0430745099 G -> DEL LOC_Os04g51840.1 N frameshift_variant Average:21.723; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430745099 NA 1.18E-16 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0430745099 NA 2.24E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430745099 NA 1.92E-07 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430745099 NA 8.19E-07 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430745099 NA 2.06E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430745099 NA 2.37E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430745099 NA 5.94E-09 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430745099 NA 1.73E-06 mr1780 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430745099 NA 6.70E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430745099 NA 1.12E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430745099 NA 9.16E-08 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430745099 NA 4.79E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430745099 NA 8.52E-32 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251