\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430611290:

Variant ID: vg0430611290 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30611290
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTCACCAGAACAAATCTTGTAATAGATCTAACGATTCAAAATTACGTGAAACTTACATGCAAGTTACACTGTAGTTACATGCAAGTTACAGTGTAATTA[T/C]
ATATAAGTTACAGTGTAATTACACTAAGATTGTACTATAATTACATCTGTCAAATTTTTAGTAGAAAATTTGTCGACAAATGTATAGGTGGTCCCATTCA

Reverse complement sequence

TGAATGGGACCACCTATACATTTGTCGACAAATTTTCTACTAAAAATTTGACAGATGTAATTATAGTACAATCTTAGTGTAATTACACTGTAACTTATAT[A/G]
TAATTACACTGTAACTTGCATGTAACTACAGTGTAACTTGCATGTAAGTTTCACGTAATTTTGAATCGTTAGATCTATTACAAGATTTGTTCTGGTGAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 37.40% 0.85% 11.70% NA
All Indica  2759 36.10% 61.30% 1.05% 1.56% NA
All Japonica  1512 78.60% 1.00% 0.33% 20.04% NA
Aus  269 13.80% 10.40% 1.49% 74.35% NA
Indica I  595 55.30% 42.90% 1.68% 0.17% NA
Indica II  465 25.20% 73.80% 0.00% 1.08% NA
Indica III  913 34.70% 63.40% 1.10% 0.77% NA
Indica Intermediate  786 29.50% 65.50% 1.15% 3.82% NA
Temperate Japonica  767 95.30% 0.10% 0.13% 4.43% NA
Tropical Japonica  504 66.70% 1.40% 0.40% 31.55% NA
Japonica Intermediate  241 50.60% 2.90% 0.83% 45.64% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 57.80% 32.20% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430611290 T -> C LOC_Os04g51640.1 upstream_gene_variant ; 4459.0bp to feature; MODIFIER silent_mutation Average:61.244; most accessible tissue: Zhenshan97 root, score: 90.472 N N N N
vg0430611290 T -> C LOC_Os04g51660.1 upstream_gene_variant ; 884.0bp to feature; MODIFIER silent_mutation Average:61.244; most accessible tissue: Zhenshan97 root, score: 90.472 N N N N
vg0430611290 T -> C LOC_Os04g51650.1 downstream_gene_variant ; 3336.0bp to feature; MODIFIER silent_mutation Average:61.244; most accessible tissue: Zhenshan97 root, score: 90.472 N N N N
vg0430611290 T -> C LOC_Os04g51680.1 downstream_gene_variant ; 4670.0bp to feature; MODIFIER silent_mutation Average:61.244; most accessible tissue: Zhenshan97 root, score: 90.472 N N N N
vg0430611290 T -> C LOC_Os04g51660-LOC_Os04g51680 intergenic_region ; MODIFIER silent_mutation Average:61.244; most accessible tissue: Zhenshan97 root, score: 90.472 N N N N
vg0430611290 T -> DEL N N silent_mutation Average:61.244; most accessible tissue: Zhenshan97 root, score: 90.472 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430611290 1.18E-06 NA mr1059 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 NA 2.97E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 6.04E-06 NA mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 3.20E-06 NA mr1167 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 6.54E-06 NA mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 NA 8.43E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 1.92E-06 NA mr1675 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 3.16E-15 6.85E-47 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 1.71E-06 6.99E-09 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 NA 2.42E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 3.39E-06 NA mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 4.66E-08 NA mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 7.09E-07 NA mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 NA 1.26E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 NA 1.65E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 NA 5.66E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 NA 6.59E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 NA 3.80E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 6.66E-22 1.22E-59 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290 4.98E-11 1.48E-14 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251