Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0430611290:

Variant ID: vg0430611290 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 30611290
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTCACCAGAACAAATCTTGTAATAGATCTAACGATTCAAAATTACGTGAAACTTACATGCAAGTTACACTGTAGTTACATGCAAGTTACAGTGTAATTA[T/C]
ATATAAGTTACAGTGTAATTACACTAAGATTGTACTATAATTACATCTGTCAAATTTTTAGTAGAAAATTTGTCGACAAATGTATAGGTGGTCCCATTCA

Reverse complement sequence

TGAATGGGACCACCTATACATTTGTCGACAAATTTTCTACTAAAAATTTGACAGATGTAATTATAGTACAATCTTAGTGTAATTACACTGTAACTTATAT[A/G]
TAATTACACTGTAACTTGCATGTAACTACAGTGTAACTTGCATGTAAGTTTCACGTAATTTTGAATCGTTAGATCTATTACAAGATTTGTTCTGGTGAGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	37.40%	0.85%	11.70%	NA
All Indica	2759	36.10%	61.30%	1.05%	1.56%	NA
All Japonica	1512	78.60%	1.00%	0.33%	20.04%	NA
Aus	269	13.80%	10.40%	1.49%	74.35%	NA
Indica I	595	55.30%	42.90%	1.68%	0.17%	NA
Indica II	465	25.20%	73.80%	0.00%	1.08%	NA
Indica III	913	34.70%	63.40%	1.10%	0.77%	NA
Indica Intermediate	786	29.50%	65.50%	1.15%	3.82%	NA
Temperate Japonica	767	95.30%	0.10%	0.13%	4.43%	NA
Tropical Japonica	504	66.70%	1.40%	0.40%	31.55%	NA
Japonica Intermediate	241	50.60%	2.90%	0.83%	45.64%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	57.80%	32.20%	2.22%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0430611290	T -> C	LOC_Os04g51640.1	upstream_gene_variant ; 4459.0bp to feature; MODIFIER	silent_mutation	Average:61.244; most accessible tissue: Zhenshan97 root, score: 90.472	N	N	N	N
vg0430611290	T -> C	LOC_Os04g51660.1	upstream_gene_variant ; 884.0bp to feature; MODIFIER	silent_mutation	Average:61.244; most accessible tissue: Zhenshan97 root, score: 90.472	N	N	N	N
vg0430611290	T -> C	LOC_Os04g51650.1	downstream_gene_variant ; 3336.0bp to feature; MODIFIER	silent_mutation	Average:61.244; most accessible tissue: Zhenshan97 root, score: 90.472	N	N	N	N
vg0430611290	T -> C	LOC_Os04g51680.1	downstream_gene_variant ; 4670.0bp to feature; MODIFIER	silent_mutation	Average:61.244; most accessible tissue: Zhenshan97 root, score: 90.472	N	N	N	N
vg0430611290	T -> C	LOC_Os04g51660-LOC_Os04g51680	intergenic_region ; MODIFIER	silent_mutation	Average:61.244; most accessible tissue: Zhenshan97 root, score: 90.472	N	N	N	N
vg0430611290	T -> DEL	N	N	silent_mutation	Average:61.244; most accessible tissue: Zhenshan97 root, score: 90.472	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0430611290	1.18E-06	NA	mr1059	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	NA	2.97E-06	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	6.04E-06	NA	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	3.20E-06	NA	mr1167	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	6.54E-06	NA	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	NA	8.43E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	1.92E-06	NA	mr1675	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	3.16E-15	6.85E-47	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	1.71E-06	6.99E-09	mr1745	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	NA	2.42E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	3.39E-06	NA	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	4.66E-08	NA	mr1064_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	7.09E-07	NA	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	NA	1.26E-06	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	NA	1.65E-06	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	NA	5.66E-08	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	NA	6.59E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	NA	3.80E-06	mr1704_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	6.66E-22	1.22E-59	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611290	4.98E-11	1.48E-14	mr1745_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251