\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430528176:

Variant ID: vg0430528176 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30528176
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATCGGCGGCCCGAGCCGCGCGGCATCTTCTCCGAGGCGGCTCTTCCCCACGCCTTCCGTTGCCCCACTGAACGCAGAGCCCCTTCTGCAGGCCTTGGCC[A/G]
TCGCTAACACCACGGTGTTGGACGGGTTAAGTGCCCAGGTGGAGGCCCTGCAAGCAGAGCGGGCGGAGCTCGACGCCGCATGGGCGCGTGTCGAAGAGGG

Reverse complement sequence

CCCTCTTCGACACGCGCCCATGCGGCGTCGAGCTCCGCCCGCTCTGCTTGCAGGGCCTCCACCTGGGCACTTAACCCGTCCAACACCGTGGTGTTAGCGA[T/C]
GGCCAAGGCCTGCAGAAGGGGCTCTGCGTTCAGTGGGGCAACGGAAGGCGTGGGGAAGAGCCGCCTCGGAGAAGATGCCGCGCGGCTCGGGCCGCCGATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 16.70% 5.82% 18.60% NA
All Indica  2759 74.00% 4.60% 5.98% 15.37% NA
All Japonica  1512 35.60% 42.10% 3.37% 18.92% NA
Aus  269 17.80% 3.70% 21.19% 57.25% NA
Indica I  595 50.60% 5.50% 9.08% 34.79% NA
Indica II  465 89.70% 3.70% 2.15% 4.52% NA
Indica III  913 77.20% 6.40% 7.45% 8.98% NA
Indica Intermediate  786 78.90% 2.40% 4.20% 14.50% NA
Temperate Japonica  767 26.60% 64.70% 3.91% 4.82% NA
Tropical Japonica  504 54.40% 14.90% 2.38% 28.37% NA
Japonica Intermediate  241 25.30% 27.00% 3.73% 43.98% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 66.70% 16.70% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430528176 A -> DEL LOC_Os04g51530.1 N frameshift_variant Average:59.758; most accessible tissue: Zhenshan97 flag leaf, score: 87.185 N N N N
vg0430528176 A -> G LOC_Os04g51530.1 missense_variant ; p.Ile575Val; MODERATE nonsynonymous_codon ; I575V Average:59.758; most accessible tissue: Zhenshan97 flag leaf, score: 87.185 benign -0.363 TOLERATED 0.52

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430528176 NA 8.98E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430528176 NA 4.77E-07 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430528176 8.46E-06 NA mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430528176 1.10E-06 1.98E-06 mr1064_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430528176 NA 1.13E-10 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430528176 NA 1.63E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430528176 NA 2.57E-10 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430528176 NA 1.55E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430528176 NA 6.73E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430528176 NA 2.04E-06 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430528176 NA 1.53E-08 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251