Search for Variation information by Variation ID:
Detailed information for vg0430528176:
| Variant ID: vg0430528176 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30528176 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CATCGGCGGCCCGAGCCGCGCGGCATCTTCTCCGAGGCGGCTCTTCCCCACGCCTTCCGTTGCCCCACTGAACGCAGAGCCCCTTCTGCAGGCCTTGGCC[A/G]
TCGCTAACACCACGGTGTTGGACGGGTTAAGTGCCCAGGTGGAGGCCCTGCAAGCAGAGCGGGCGGAGCTCGACGCCGCATGGGCGCGTGTCGAAGAGGG
Reverse complement sequence
CCCTCTTCGACACGCGCCCATGCGGCGTCGAGCTCCGCCCGCTCTGCTTGCAGGGCCTCCACCTGGGCACTTAACCCGTCCAACACCGTGGTGTTAGCGA[T/C]
GGCCAAGGCCTGCAGAAGGGGCTCTGCGTTCAGTGGGGCAACGGAAGGCGTGGGGAAGAGCCGCCTCGGAGAAGATGCCGCGCGGCTCGGGCCGCCGATG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.90% | 16.70% | 5.82% | 18.60% | NA |
| All Indica | 2759 | 74.00% | 4.60% | 5.98% | 15.37% | NA |
| All Japonica | 1512 | 35.60% | 42.10% | 3.37% | 18.92% | NA |
| Aus | 269 | 17.80% | 3.70% | 21.19% | 57.25% | NA |
| Indica I | 595 | 50.60% | 5.50% | 9.08% | 34.79% | NA |
| Indica II | 465 | 89.70% | 3.70% | 2.15% | 4.52% | NA |
| Indica III | 913 | 77.20% | 6.40% | 7.45% | 8.98% | NA |
| Indica Intermediate | 786 | 78.90% | 2.40% | 4.20% | 14.50% | NA |
| Temperate Japonica | 767 | 26.60% | 64.70% | 3.91% | 4.82% | NA |
| Tropical Japonica | 504 | 54.40% | 14.90% | 2.38% | 28.37% | NA |
| Japonica Intermediate | 241 | 25.30% | 27.00% | 3.73% | 43.98% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 66.70% | 16.70% | 1.11% | 15.56% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430528176 | A -> DEL | LOC_Os04g51530.1 | N | frameshift_variant | Average:59.758; most accessible tissue: Zhenshan97 flag leaf, score: 87.185 | N | N | N | N |
| vg0430528176 | A -> G | LOC_Os04g51530.1 | missense_variant ; p.Ile575Val; MODERATE | nonsynonymous_codon ; I575V | Average:59.758; most accessible tissue: Zhenshan97 flag leaf, score: 87.185 | benign  |
-0.363 |
TOLERATED | 0.52 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430528176 | NA | 8.98E-06 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430528176 | NA | 4.77E-07 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430528176 | 8.46E-06 | NA | mr1064_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430528176 | 1.10E-06 | 1.98E-06 | mr1064_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430528176 | NA | 1.13E-10 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430528176 | NA | 1.63E-08 | mr1174_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430528176 | NA | 2.57E-10 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430528176 | NA | 1.55E-07 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430528176 | NA | 6.73E-06 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430528176 | NA | 2.04E-06 | mr1406_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430528176 | NA | 1.53E-08 | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |