\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430365268:

Variant ID: vg0430365268 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30365268
Reference Allele: TAlternative Allele: G,A
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCACCTAACCCGTGATCTGACCGGTCTGTGACCGGTCACAGACCGGATAAAGGAACGCGCTGCACTGCGCTGCATGCAGCGTGACACGCTTGACCAGACC[T/G,A]
CAATAAACGCGGTTAGGTGAGCCCTGCCGTGTTCACCTAACCCATACATGTGACGAAAAAACCCACAAGGGGCCGGGGCGCCTCGGCCCTCGGGGCCGGG

Reverse complement sequence

CCCGGCCCCGAGGGCCGAGGCGCCCCGGCCCCTTGTGGGTTTTTTCGTCACATGTATGGGTTAGGTGAACACGGCAGGGCTCACCTAACCGCGTTTATTG[A/C,T]
GGTCTGGTCAAGCGTGTCACGCTGCATGCAGCGCAGTGCAGCGCGTTCCTTTATCCGGTCTGTGACCGGTCACAGACCGGTCAGATCACGGGTTAGGTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.20% 9.20% 31.10% 36.39% A: 0.08%
All Indica  2759 2.60% 13.70% 41.50% 42.23% NA
All Japonica  1512 62.60% 2.40% 8.33% 26.59% NA
Aus  269 1.50% 4.80% 46.10% 47.58% NA
Indica I  595 2.40% 14.80% 44.37% 38.49% NA
Indica II  465 2.80% 18.30% 36.77% 42.15% NA
Indica III  913 2.00% 11.40% 44.14% 42.50% NA
Indica Intermediate  786 3.40% 12.70% 39.06% 44.78% NA
Temperate Japonica  767 90.60% 0.10% 1.17% 8.08% NA
Tropical Japonica  504 31.90% 6.90% 19.84% 41.27% NA
Japonica Intermediate  241 37.80% 0.40% 7.05% 54.77% NA
VI/Aromatic  96 44.80% 4.20% 44.79% 2.08% A: 4.17%
Intermediate  90 33.30% 5.60% 35.56% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430365268 T -> A LOC_Os04g51240.1 upstream_gene_variant ; 1610.0bp to feature; MODIFIER silent_mutation Average:67.629; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg0430365268 T -> A LOC_Os04g51250.1 downstream_gene_variant ; 661.0bp to feature; MODIFIER silent_mutation Average:67.629; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg0430365268 T -> A LOC_Os04g51240-LOC_Os04g51250 intergenic_region ; MODIFIER silent_mutation Average:67.629; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg0430365268 T -> DEL N N silent_mutation Average:67.629; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg0430365268 T -> G LOC_Os04g51240.1 upstream_gene_variant ; 1610.0bp to feature; MODIFIER silent_mutation Average:67.629; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg0430365268 T -> G LOC_Os04g51250.1 downstream_gene_variant ; 661.0bp to feature; MODIFIER silent_mutation Average:67.629; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg0430365268 T -> G LOC_Os04g51240-LOC_Os04g51250 intergenic_region ; MODIFIER silent_mutation Average:67.629; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430365268 T A 0.0 0.01 0.01 0.0 0.01 0.0
vg0430365268 T G -0.03 -0.02 -0.01 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430365268 NA 5.32E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 1.81E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 3.64E-08 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 5.29E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 2.37E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 6.66E-31 mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 9.28E-34 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 6.67E-39 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 2.02E-18 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 2.31E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 2.55E-17 mr1169 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 8.53E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 4.10E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 4.97E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 9.16E-14 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 1.33E-35 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 1.42E-25 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 6.00E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 3.22E-29 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 6.32E-40 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 2.19E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 1.44E-29 mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 1.33E-41 mr1620 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 3.05E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 4.20E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 1.38E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 1.51E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 3.56E-08 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 1.53E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 3.66E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 3.37E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 6.84E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 7.41E-32 mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430365268 NA 9.81E-14 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251