Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430022461:

Variant ID: vg0430022461 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 30022461
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

AACAGGACCTTACTCTAGCAACAAACTCGATGCATGTACCATCCCCACTATTTCCTAGCCAATGACAAATCAAGATATTGCATGTGGGTTATAAATACTT[A/G]
TGTGCATGGATGCATGCATCAATGTCCATTTACTCCAAATGCACAAATAACGAATATACTTAATGAATGAACACAAATATATAAATCATTTAGGAATAAC

Reverse complement sequence

GTTATTCCTAAATGATTTATATATTTGTGTTCATTCATTAAGTATATTCGTTATTTGTGCATTTGGAGTAAATGGACATTGATGCATGCATCCATGCACA[T/C]
AAGTATTTATAACCCACATGCAATATCTTGATTTGTCATTGGCTAGGAAATAGTGGGGATGGTACATGCATCGAGTTTGTTGCTAGAGTAAGGTCCTGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.90%	49.80%	0.23%	0.02%	NA
All Indica	2759	54.40%	45.20%	0.36%	0.04%	NA
All Japonica	1512	52.40%	47.50%	0.07%	0.00%	NA
Aus	269	10.40%	89.60%	0.00%	0.00%	NA
Indica I	595	75.50%	24.50%	0.00%	0.00%	NA
Indica II	465	22.20%	77.40%	0.43%	0.00%	NA
Indica III	913	57.30%	42.70%	0.00%	0.00%	NA
Indica Intermediate	786	54.20%	44.70%	1.02%	0.13%	NA
Temperate Japonica	767	91.70%	8.30%	0.00%	0.00%	NA
Tropical Japonica	504	7.90%	91.90%	0.20%	0.00%	NA
Japonica Intermediate	241	20.70%	79.30%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	32.20%	67.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0430022461	A -> DEL	N	N	silent_mutation	Average:43.391; most accessible tissue: Zhenshan97 root, score: 66.289	N	N	N	N
vg0430022461	A -> G	LOC_Os04g50750.1	upstream_gene_variant ; 753.0bp to feature; MODIFIER	silent_mutation	Average:43.391; most accessible tissue: Zhenshan97 root, score: 66.289	N	N	N	N
vg0430022461	A -> G	LOC_Os04g50740.1	downstream_gene_variant ; 1388.0bp to feature; MODIFIER	silent_mutation	Average:43.391; most accessible tissue: Zhenshan97 root, score: 66.289	N	N	N	N
vg0430022461	A -> G	LOC_Os04g50760.1	downstream_gene_variant ; 275.0bp to feature; MODIFIER	silent_mutation	Average:43.391; most accessible tissue: Zhenshan97 root, score: 66.289	N	N	N	N
vg0430022461	A -> G	LOC_Os04g50750-LOC_Os04g50760	intergenic_region ; MODIFIER	silent_mutation	Average:43.391; most accessible tissue: Zhenshan97 root, score: 66.289	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0430022461	NA	4.66E-07	mr1169	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	4.55E-07	8.35E-11	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	2.39E-07	5.37E-16	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	NA	2.03E-08	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	NA	7.51E-11	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	NA	3.17E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	NA	2.44E-06	mr1406	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	NA	1.57E-06	mr1406	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	NA	8.48E-09	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	NA	1.50E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	NA	7.51E-12	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	NA	3.01E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	1.39E-06	5.35E-10	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	2.92E-08	1.67E-19	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	7.67E-08	1.12E-13	mr1347_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	2.05E-09	7.04E-22	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	NA	2.95E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	NA	1.04E-06	mr1406_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	NA	4.92E-10	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	NA	8.23E-07	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	NA	2.93E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461	NA	9.96E-09	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251