\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430022461:

Variant ID: vg0430022461 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30022461
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


AACAGGACCTTACTCTAGCAACAAACTCGATGCATGTACCATCCCCACTATTTCCTAGCCAATGACAAATCAAGATATTGCATGTGGGTTATAAATACTT[A/G]
TGTGCATGGATGCATGCATCAATGTCCATTTACTCCAAATGCACAAATAACGAATATACTTAATGAATGAACACAAATATATAAATCATTTAGGAATAAC

Reverse complement sequence

GTTATTCCTAAATGATTTATATATTTGTGTTCATTCATTAAGTATATTCGTTATTTGTGCATTTGGAGTAAATGGACATTGATGCATGCATCCATGCACA[T/C]
AAGTATTTATAACCCACATGCAATATCTTGATTTGTCATTGGCTAGGAAATAGTGGGGATGGTACATGCATCGAGTTTGTTGCTAGAGTAAGGTCCTGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.90% 49.80% 0.23% 0.02% NA
All Indica  2759 54.40% 45.20% 0.36% 0.04% NA
All Japonica  1512 52.40% 47.50% 0.07% 0.00% NA
Aus  269 10.40% 89.60% 0.00% 0.00% NA
Indica I  595 75.50% 24.50% 0.00% 0.00% NA
Indica II  465 22.20% 77.40% 0.43% 0.00% NA
Indica III  913 57.30% 42.70% 0.00% 0.00% NA
Indica Intermediate  786 54.20% 44.70% 1.02% 0.13% NA
Temperate Japonica  767 91.70% 8.30% 0.00% 0.00% NA
Tropical Japonica  504 7.90% 91.90% 0.20% 0.00% NA
Japonica Intermediate  241 20.70% 79.30% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 32.20% 67.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430022461 A -> DEL N N silent_mutation Average:43.391; most accessible tissue: Zhenshan97 root, score: 66.289 N N N N
vg0430022461 A -> G LOC_Os04g50750.1 upstream_gene_variant ; 753.0bp to feature; MODIFIER silent_mutation Average:43.391; most accessible tissue: Zhenshan97 root, score: 66.289 N N N N
vg0430022461 A -> G LOC_Os04g50740.1 downstream_gene_variant ; 1388.0bp to feature; MODIFIER silent_mutation Average:43.391; most accessible tissue: Zhenshan97 root, score: 66.289 N N N N
vg0430022461 A -> G LOC_Os04g50760.1 downstream_gene_variant ; 275.0bp to feature; MODIFIER silent_mutation Average:43.391; most accessible tissue: Zhenshan97 root, score: 66.289 N N N N
vg0430022461 A -> G LOC_Os04g50750-LOC_Os04g50760 intergenic_region ; MODIFIER silent_mutation Average:43.391; most accessible tissue: Zhenshan97 root, score: 66.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430022461 NA 4.66E-07 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 4.55E-07 8.35E-11 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 2.39E-07 5.37E-16 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 NA 2.03E-08 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 NA 7.51E-11 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 NA 3.17E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 NA 2.44E-06 mr1406 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 NA 1.57E-06 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 NA 8.48E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 NA 1.50E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 NA 7.51E-12 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 NA 3.01E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 1.39E-06 5.35E-10 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 2.92E-08 1.67E-19 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 7.67E-08 1.12E-13 mr1347_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 2.05E-09 7.04E-22 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 NA 2.95E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 NA 1.04E-06 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 NA 4.92E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 NA 8.23E-07 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 NA 2.93E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430022461 NA 9.96E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251