\
| Variant ID: vg0429780859 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 29780859 |
| Reference Allele: A | Alternative Allele: T,ACTCT,ACACT,ACTCTCTCT |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTACCTGCATCGAAGAAAGAGGCAACAAGTCAGAAGACCATAATGCCACAATCCATATTGGCGCGCGCGCGCAGACCCACCCACCCACACACACACACAC[A/T,ACTCT,ACACT,ACTCTCTCT]
CTCTTAAGCTTTGAAAAAAAAGGAAATGAGCTGCAAAAGAACCTGGTATCAAATATTCCATATCGATTTCAGCATCGAGGTGAAAGAAATGAATTGAAAA
TTTTCAATTCATTTCTTTCACCTCGATGCTGAAATCGATATGGAATATTTGATACCAGGTTCTTTTGCAGCTCATTTCCTTTTTTTTCAAAGCTTAAGAG[T/A,AGAGT,AGTGT,AGAGAGAGT]
GTGTGTGTGTGTGTGGGTGGGTGGGTCTGCGCGCGCGCGCCAATATGGATTGTGGCATTATGGTCTTCTGACTTGTTGCCTCTTTCTTCGATGCAGGTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 2.30% | 12.74% | 15.38% | ACACT: 1.69%; ACTCT: 1.40%; ACTCTCTCT: 0.04% |
| All Indica | 2759 | 44.40% | 3.90% | 21.28% | 25.26% | ACACT: 2.86%; ACTCT: 2.36% |
| All Japonica | 1512 | 99.80% | 0.00% | 0.07% | 0.13% | NA |
| Aus | 269 | 91.10% | 0.40% | 1.12% | 7.43% | NA |
| Indica I | 595 | 67.70% | 1.30% | 11.60% | 18.82% | ACTCT: 0.50% |
| Indica II | 465 | 18.10% | 8.20% | 40.65% | 25.16% | ACTCT: 6.88%; ACACT: 1.08% |
| Indica III | 913 | 43.50% | 3.60% | 19.06% | 24.75% | ACACT: 7.23%; ACTCT: 1.86% |
| Indica Intermediate | 786 | 43.30% | 3.60% | 19.72% | 30.79% | ACTCT: 1.65%; ACACT: 1.02% |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 0.00% | 12.22% | 8.89% | ACTCTCTCT: 2.22%; ACACT: 1.11%; ACTCT: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0429780859 | A -> DEL | N | N | silent_mutation | Average:65.024; most accessible tissue: Minghui63 root, score: 78.833 | N | N | N | N |
| vg0429780859 | A -> T | LOC_Os04g49930.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.024; most accessible tissue: Minghui63 root, score: 78.833 | N | N | N | N |
| vg0429780859 | A -> ACTCT | LOC_Os04g49930.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.024; most accessible tissue: Minghui63 root, score: 78.833 | N | N | N | N |
| vg0429780859 | A -> ACACT | LOC_Os04g49930.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.024; most accessible tissue: Minghui63 root, score: 78.833 | N | N | N | N |
| vg0429780859 | A -> ACTCTCTCT | LOC_Os04g49930.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.024; most accessible tissue: Minghui63 root, score: 78.833 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0429780859 | NA | 3.48E-09 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429780859 | 2.95E-07 | 2.93E-07 | mr1267 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429780859 | NA | 3.34E-07 | mr1380 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429780859 | NA | 6.82E-08 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429780859 | NA | 4.27E-07 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429780859 | NA | 3.48E-06 | mr1908 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429780859 | NA | 3.54E-07 | mr1937 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429780859 | NA | 2.53E-06 | mr1937 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429780859 | 5.79E-06 | 5.80E-06 | mr1996 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |