\
| Variant ID: vg0429371515 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 29371515 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAATTTTAATAATTATTTTTACCGGGTTGTAGTGTTTTAGTTGCAATTAGTTTTTTAACTAAAAATTGAAAAACAATTTATTGATTGATTAAAATATATC[A/C]
TTTGTACTTGTCTTTTCCAGTATATTCACAGTAGATATTAAAAATACAAACACTACAATCTAGTAATGTTATTTTGACTTATTCTAATGTTATAATGGGG
CCCCATTATAACATTAGAATAAGTCAAAATAACATTACTAGATTGTAGTGTTTGTATTTTTAATATCTACTGTGAATATACTGGAAAAGACAAGTACAAA[T/G]
GATATATTTTAATCAATCAATAAATTGTTTTTCAATTTTTAGTTAAAAAACTAATTGCAACTAAAACACTACAACCCGGTAAAAATAATTATTAAAATTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.00% | 16.30% | 0.51% | 0.13% | NA |
| All Indica | 2759 | 97.80% | 1.50% | 0.47% | 0.22% | NA |
| All Japonica | 1512 | 52.50% | 47.00% | 0.53% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.40% | 0.40% | 1.08% | 1.08% | NA |
| Indica III | 913 | 99.20% | 0.40% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 96.30% | 3.10% | 0.51% | 0.13% | NA |
| Temperate Japonica | 767 | 16.30% | 82.90% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.50% | 18.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 17.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0429371515 | A -> C | LOC_Os04g49230.1 | upstream_gene_variant ; 3000.0bp to feature; MODIFIER | silent_mutation | Average:13.651; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0429371515 | A -> C | LOC_Os04g49230-LOC_Os04g49240 | intergenic_region ; MODIFIER | silent_mutation | Average:13.651; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0429371515 | A -> DEL | N | N | silent_mutation | Average:13.651; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0429371515 | 3.25E-06 | NA | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0429371515 | NA | 8.84E-06 | mr1180 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 9.63E-13 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 5.73E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 8.39E-07 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 5.46E-11 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 1.84E-08 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 7.08E-07 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 4.71E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 3.98E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 1.12E-09 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 9.87E-06 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 1.59E-08 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 5.17E-13 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 1.69E-07 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 1.08E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 2.52E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429371515 | NA | 2.62E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |