\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429316121:

Variant ID: vg0429316121 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29316121
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, T: 0.08, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAATTTTTTTGGAGTGTGAAAACGATAAGTATTTTTTTAAAAAACATAAATGCTAAAACAAGAAGTAATTTCAAACATAGGAAGTATATATAAACAA[G/T]
AGTAGGACTATTACCCAAACCGAGGGTCTAAACCTATATAAAAATATTTTCTGTTGTCTTTGGTTATAGGTCTGACAATATCCTCGTATCCACCATATGT

Reverse complement sequence

ACATATGGTGGATACGAGGATATTGTCAGACCTATAACCAAAGACAACAGAAAATATTTTTATATAGGTTTAGACCCTCGGTTTGGGTAATAGTCCTACT[C/A]
TTGTTTATATATACTTCCTATGTTTGAAATTACTTCTTGTTTTAGCATTTATGTTTTTTAAAAAAATACTTATCGTTTTCACACTCCAAAAAAATTTTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.30% 46.20% 0.15% 0.34% NA
All Indica  2759 86.90% 12.60% 0.18% 0.33% NA
All Japonica  1512 0.40% 99.30% 0.00% 0.26% NA
Aus  269 28.30% 71.40% 0.00% 0.37% NA
Indica I  595 97.30% 2.50% 0.00% 0.17% NA
Indica II  465 95.30% 4.10% 0.22% 0.43% NA
Indica III  913 74.90% 24.60% 0.11% 0.33% NA
Indica Intermediate  786 88.00% 11.20% 0.38% 0.38% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.00% 0.00% 0.40% NA
Japonica Intermediate  241 0.40% 98.80% 0.00% 0.83% NA
VI/Aromatic  96 4.20% 94.80% 1.04% 0.00% NA
Intermediate  90 40.00% 56.70% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429316121 G -> DEL N N silent_mutation Average:40.987; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N
vg0429316121 G -> T LOC_Os04g49150.1 downstream_gene_variant ; 2009.0bp to feature; MODIFIER silent_mutation Average:40.987; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N
vg0429316121 G -> T LOC_Os04g49160.1 downstream_gene_variant ; 1082.0bp to feature; MODIFIER silent_mutation Average:40.987; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N
vg0429316121 G -> T LOC_Os04g49150-LOC_Os04g49160 intergenic_region ; MODIFIER silent_mutation Average:40.987; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429316121 NA 5.85E-27 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 2.71E-06 1.45E-08 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 1.81E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 4.72E-26 mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 1.16E-08 5.43E-10 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 1.01E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 7.77E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 8.12E-34 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 8.51E-07 2.87E-10 mr1104 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 8.51E-39 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 1.77E-07 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 7.15E-29 mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 2.71E-07 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 1.86E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 3.18E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 2.73E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 6.67E-30 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 4.79E-07 2.29E-10 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 1.21E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 3.13E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 9.51E-06 7.54E-09 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 9.08E-29 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 2.28E-06 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 3.06E-39 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 9.75E-09 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 7.82E-30 mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 1.79E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 2.66E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429316121 NA 3.02E-08 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251