\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429231335:

Variant ID: vg0429231335 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29231335
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


CCTGCGGCACATATGGCTCGAACGCAAGTGCCGGAACGATCATTGGCAACTCAGGCTGCCCGCGCTGCTGGACATCCTCGACATCAACATCTCTACAAAC[G/A]
ACAACAAAGTACTCGAGATCAAAATGCTAAAGAAAACTAAGGTGACGACTGCACACACAAAGGCGGTTGGAACCAATGAGAGTTTTTACAAAGCATGACT

Reverse complement sequence

AGTCATGCTTTGTAAAAACTCTCATTGGTTCCAACCGCCTTTGTGTGTGCAGTCGTCACCTTAGTTTTCTTTAGCATTTTGATCTCGAGTACTTTGTTGT[C/T]
GTTTGTAGAGATGTTGATGTCGAGGATGTCCAGCAGCGCGGGCAGCCTGAGTTGCCAATGATCGTTCCGGCACTTGCGTTCGAGCCATATGTGCCGCAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.00% 48.90% 1.25% 0.93% NA
All Indica  2759 19.50% 79.10% 0.11% 1.34% NA
All Japonica  1512 94.20% 2.10% 3.57% 0.20% NA
Aus  269 78.40% 21.60% 0.00% 0.00% NA
Indica I  595 2.40% 95.30% 0.00% 2.35% NA
Indica II  465 6.50% 92.50% 0.00% 1.08% NA
Indica III  913 38.80% 60.50% 0.11% 0.66% NA
Indica Intermediate  786 17.70% 80.50% 0.25% 1.53% NA
Temperate Japonica  767 96.10% 0.40% 3.52% 0.00% NA
Tropical Japonica  504 99.00% 0.20% 0.40% 0.40% NA
Japonica Intermediate  241 78.00% 11.20% 10.37% 0.41% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 55.60% 37.80% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429231335 G -> DEL N N silent_mutation Average:45.81; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0429231335 G -> A LOC_Os04g49020.1 downstream_gene_variant ; 3916.0bp to feature; MODIFIER silent_mutation Average:45.81; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0429231335 G -> A LOC_Os04g49030.1 downstream_gene_variant ; 1393.0bp to feature; MODIFIER silent_mutation Average:45.81; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0429231335 G -> A LOC_Os04g49040.1 intron_variant ; MODIFIER silent_mutation Average:45.81; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429231335 NA 2.00E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429231335 NA 7.72E-14 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429231335 NA 9.50E-12 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429231335 NA 1.19E-29 mr1237 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429231335 NA 1.63E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429231335 NA 4.74E-06 mr1437 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429231335 NA 3.13E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429231335 NA 9.08E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429231335 NA 7.13E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429231335 NA 1.76E-11 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429231335 NA 2.92E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429231335 NA 1.18E-08 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429231335 NA 1.71E-07 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429231335 NA 4.93E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251